Incidental Mutation 'R6112:Lcor'
ID 484930
Institutional Source Beutler Lab
Gene Symbol Lcor
Ensembl Gene ENSMUSG00000025019
Gene Name ligand dependent nuclear receptor corepressor
Synonyms A630025C20Rik, Mlr2, 3110023F06Rik
MMRRC Submission 044261-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock # R6112 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 41482645-41562246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41559081 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 368 (V368A)
Ref Sequence ENSEMBL: ENSMUSP00000126441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]
AlphaFold Q6ZPI3
Predicted Effect possibly damaging
Transcript: ENSMUST00000067795
AA Change: V368A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019
AA Change: V368A

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 1.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163929
AA Change: V368A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019
AA Change: V368A

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 5.1e-18 PFAM
Meta Mutation Damage Score 0.6439 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 A G 16: 14,460,916 Y1030C probably damaging Het
Adh5 G T 3: 138,451,268 V197F probably damaging Het
Ankmy1 A T 1: 92,870,962 F936I probably damaging Het
Aoc1 A T 6: 48,908,691 D710V probably damaging Het
Aplp1 T C 7: 30,435,477 E622G probably damaging Het
Arhgap20 T C 9: 51,829,384 Y219H probably damaging Het
Bag3 A G 7: 128,541,832 D184G probably damaging Het
Cacna1g C T 11: 94,409,246 A2216T probably damaging Het
Cbarp T C 10: 80,135,371 probably null Het
Cep250 C A 2: 155,994,583 L2211I possibly damaging Het
Cfap65 A G 1: 74,903,139 I1752T probably benign Het
Col4a4 A G 1: 82,453,883 V1560A unknown Het
Dapk3 A T 10: 81,184,030 Q6L probably benign Het
Dctn5 A G 7: 122,133,237 probably benign Het
Eef1akmt1 A T 14: 57,549,873 I182N possibly damaging Het
Eef1g T C 19: 8,977,591 F346S probably damaging Het
Erap1 G T 13: 74,646,279 W19L probably benign Het
Gm10801 A G 2: 98,664,064 H162R probably benign Het
Gpm6a G A 8: 55,054,810 A194T probably benign Het
Grip1 C A 10: 119,993,232 N32K probably benign Het
Hmcn1 A G 1: 150,618,936 I4134T probably damaging Het
Hspa14 G A 2: 3,498,068 H230Y probably benign Het
Ift172 T C 5: 31,256,897 T1435A probably benign Het
Igsf3 T A 3: 101,451,006 Y738N probably damaging Het
Lmna C A 3: 88,486,621 E217* probably null Het
Lrp1b C T 2: 41,341,882 G337E probably benign Het
Maf1 A G 15: 76,352,112 probably benign Het
Magi1 T C 6: 93,745,590 I436V probably damaging Het
Muc4 C T 16: 32,775,783 T3123I possibly damaging Het
Muc5b T A 7: 141,863,305 H3329Q probably benign Het
Noa1 C T 5: 77,309,746 R104Q probably benign Het
Odc1 T G 12: 17,549,472 S267A probably benign Het
Olfr484 T A 7: 108,125,162 I34F probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Pamr1 T C 2: 102,611,608 Y181H probably damaging Het
Pcdhga2 T A 18: 37,669,559 I152N probably damaging Het
Pigt C T 2: 164,506,445 Q437* probably null Het
Prx T C 7: 27,516,548 L158P probably damaging Het
Ptprh T A 7: 4,597,923 T152S probably benign Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rad51ap2 T C 12: 11,457,289 I404T probably benign Het
Radil C T 5: 142,543,644 R99H probably damaging Het
Rc3h2 C T 2: 37,378,887 V856I possibly damaging Het
Slx4ip T A 2: 137,046,744 V115E probably damaging Het
Snx3 C A 10: 42,526,046 S85R probably benign Het
Sppl2c A T 11: 104,187,137 E254D probably benign Het
Srms C A 2: 181,207,987 E237* probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Trank1 T C 9: 111,391,737 L2514P probably damaging Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Usp4 A G 9: 108,356,504 Y108C probably damaging Het
Vmn2r60 A T 7: 42,195,423 I737F probably damaging Het
Zfp600 A T 4: 146,195,131 H123L probably benign Het
Zfp646 G T 7: 127,879,018 R122S possibly damaging Het
Znfx1 A G 2: 167,038,206 Y553H probably benign Het
Other mutations in Lcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lcor APN 19 41552700 missense probably damaging 0.97
IGL02079:Lcor APN 19 41555687 missense probably benign 0.40
IGL02100:Lcor APN 19 41558754 missense possibly damaging 0.93
IGL02444:Lcor APN 19 41559011 missense probably damaging 0.99
IGL02578:Lcor APN 19 41559150 missense probably damaging 1.00
IGL03072:Lcor APN 19 41558814 missense possibly damaging 0.85
IGL03118:Lcor APN 19 41558369 missense probably damaging 0.99
IGL03153:Lcor APN 19 41558356 missense probably damaging 0.98
R1756:Lcor UTSW 19 41559266 missense probably benign
R1889:Lcor UTSW 19 41559128 missense probably damaging 0.99
R1913:Lcor UTSW 19 41558474 missense probably benign 0.40
R1983:Lcor UTSW 19 41558367 missense probably damaging 0.98
R3885:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3886:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3888:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3889:Lcor UTSW 19 41558356 missense probably damaging 0.98
R5160:Lcor UTSW 19 41555614 missense probably damaging 0.99
R7777:Lcor UTSW 19 41558795 missense probably benign 0.33
R8556:Lcor UTSW 19 41558424 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTGATTCTTGGGGCTCAG -3'
(R):5'- CCAGTTTGTACAGTAATTGGCAC -3'

Sequencing Primer
(F):5'- AGATGCTGAGCAGTCTACCTCTG -3'
(R):5'- GTTTGTACAGTAATTGGCACTCTAC -3'
Posted On 2017-08-16