Incidental Mutation 'R0520:Dhx57'
ID 48494
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene Name DExH-box helicase 57
Synonyms
MMRRC Submission 038713-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.190) question?
Stock # R0520 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 80545733-80597620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 80565604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 816 (V816A)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
AlphaFold Q6P5D3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038166
AA Change: V763A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V763A

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086555
AA Change: V816A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V816A

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Meta Mutation Damage Score 0.1107 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 T C 14: 103,288,952 (GRCm39) I154T possibly damaging Het
Acr G T 15: 89,457,430 (GRCm39) C226F probably damaging Het
Aff1 C T 5: 103,995,617 (GRCm39) R1070* probably null Het
Aldh9a1 C T 1: 167,188,960 (GRCm39) probably benign Het
Apaf1 A T 10: 90,915,851 (GRCm39) H12Q probably damaging Het
Asic1 A T 15: 99,593,416 (GRCm39) I291F probably damaging Het
Aspm T A 1: 139,406,558 (GRCm39) M1815K possibly damaging Het
Asxl3 A T 18: 22,656,043 (GRCm39) D1351V probably damaging Het
Atg9a C T 1: 75,163,178 (GRCm39) W299* probably null Het
B3gntl1 C A 11: 121,514,314 (GRCm39) V313F possibly damaging Het
B4galnt4 T A 7: 140,647,286 (GRCm39) C345* probably null Het
Bicc1 A T 10: 70,793,020 (GRCm39) F211L probably damaging Het
Cachd1 T G 4: 100,754,900 (GRCm39) V117G probably damaging Het
Cdc16 G A 8: 13,810,569 (GRCm39) probably null Het
Cers6 C T 2: 68,935,435 (GRCm39) Q312* probably null Het
Csta2 A G 16: 36,073,461 (GRCm39) I16V probably benign Het
Dclre1c A G 2: 3,437,512 (GRCm39) H115R probably damaging Het
Ddx20 T C 3: 105,594,692 (GRCm39) T18A probably benign Het
Dlgap1 C T 17: 70,823,989 (GRCm39) Q325* probably null Het
Dnaja1 A T 4: 40,728,072 (GRCm39) M178L probably benign Het
Ecd A T 14: 20,378,732 (GRCm39) S454T probably benign Het
Efcab6 G A 15: 83,834,247 (GRCm39) H454Y probably benign Het
Exo1 T A 1: 175,727,031 (GRCm39) D447E probably benign Het
F5 T G 1: 164,037,156 (GRCm39) I1965S probably benign Het
Fbn2 A G 18: 58,146,821 (GRCm39) C2692R probably damaging Het
Fggy T A 4: 95,489,340 (GRCm39) L152Q probably damaging Het
Glb1 ACCC ACC 9: 114,250,812 (GRCm39) probably null Het
Gm9871 A G 6: 101,778,540 (GRCm39) noncoding transcript Het
Gnai2 A T 9: 107,497,372 (GRCm39) D7E probably benign Het
Gon7 C T 12: 102,724,047 (GRCm39) probably benign Het
H2-K2 A T 17: 34,216,390 (GRCm39) V272E probably damaging Het
Hectd4 G T 5: 121,469,770 (GRCm39) R2555L possibly damaging Het
Hexb T C 13: 97,317,618 (GRCm39) R360G probably benign Het
Igsf9b C A 9: 27,234,546 (GRCm39) S470R probably benign Het
Inpp5d T C 1: 87,633,642 (GRCm39) probably benign Het
Inpp5k C A 11: 75,530,356 (GRCm39) Y265* probably null Het
Klhl33 T G 14: 51,129,140 (GRCm39) E436D probably damaging Het
Krt80 A G 15: 101,267,898 (GRCm39) L13P probably benign Het
Krtap19-2 C T 16: 88,670,749 (GRCm39) probably benign Het
Marchf10 T C 11: 105,280,708 (GRCm39) T526A probably benign Het
Mcrs1 A G 15: 99,146,336 (GRCm39) probably null Het
Msh2 G T 17: 88,024,972 (GRCm39) V617F possibly damaging Het
Nckap1 A C 2: 80,371,874 (GRCm39) probably benign Het
Nek4 T A 14: 30,681,263 (GRCm39) probably benign Het
Or7h8 G A 9: 20,123,791 (GRCm39) V49I probably benign Het
Or8b12b T C 9: 37,684,849 (GRCm39) V298A probably benign Het
Or8k22 G T 2: 86,163,475 (GRCm39) T75K probably damaging Het
Or9s14 T A 1: 92,536,471 (GRCm39) V304E probably damaging Het
Osgin1 A G 8: 120,169,247 (GRCm39) H48R probably damaging Het
Pam T A 1: 97,811,920 (GRCm39) T369S probably benign Het
Pclo C T 5: 14,763,844 (GRCm39) Q821* probably null Het
Plekhm1 T C 11: 103,285,770 (GRCm39) I222V probably benign Het
Ptprg T G 14: 12,199,783 (GRCm38) N65K possibly damaging Het
Pum2 T A 12: 8,771,710 (GRCm39) V351E probably damaging Het
Slc25a54 T A 3: 109,014,546 (GRCm39) probably benign Het
Smchd1 A T 17: 71,736,538 (GRCm39) D587E possibly damaging Het
Stap1 A G 5: 86,238,823 (GRCm39) M164V probably benign Het
Stat5a T C 11: 100,752,252 (GRCm39) V30A probably damaging Het
Stk36 T G 1: 74,641,365 (GRCm39) probably benign Het
Tiam1 G T 16: 89,614,839 (GRCm39) probably benign Het
Tmc5 T C 7: 118,265,799 (GRCm39) M553T probably damaging Het
Tmem14a T A 1: 21,299,636 (GRCm39) Y89N possibly damaging Het
Tpp2 A G 1: 44,029,690 (GRCm39) Y991C probably damaging Het
Ttc7 A G 17: 87,666,579 (GRCm39) K615E possibly damaging Het
Ubac2 C T 14: 122,231,754 (GRCm39) P227S probably damaging Het
Vit A C 17: 78,932,588 (GRCm39) K565T probably damaging Het
Vps13c T C 9: 67,853,133 (GRCm39) F2409L possibly damaging Het
Wdr64 A G 1: 175,553,958 (GRCm39) T173A probably damaging Het
Zfp759 T C 13: 67,285,419 (GRCm39) I60T probably benign Het
Zfp81 A G 17: 33,553,351 (GRCm39) S488P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,713,776 (GRCm39) probably benign Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80,582,405 (GRCm39) missense probably benign 0.00
IGL00811:Dhx57 APN 17 80,560,672 (GRCm39) missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80,588,652 (GRCm39) missense probably benign 0.28
IGL01468:Dhx57 APN 17 80,563,039 (GRCm39) nonsense probably null
IGL01908:Dhx57 APN 17 80,558,872 (GRCm39) missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80,576,279 (GRCm39) missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80,567,752 (GRCm39) missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80,582,268 (GRCm39) missense probably benign 0.13
IGL02349:Dhx57 APN 17 80,563,000 (GRCm39) missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80,562,979 (GRCm39) critical splice donor site probably null
IGL02588:Dhx57 APN 17 80,576,300 (GRCm39) missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80,574,974 (GRCm39) missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80,574,978 (GRCm39) missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80,554,581 (GRCm39) missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80,565,526 (GRCm39) missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80,582,620 (GRCm39) missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80,571,404 (GRCm39) missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80,546,343 (GRCm39) missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80,558,902 (GRCm39) missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80,582,310 (GRCm39) missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80,565,550 (GRCm39) missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80,582,226 (GRCm39) missense probably benign 0.34
R0554:Dhx57 UTSW 17 80,567,665 (GRCm39) nonsense probably null
R0661:Dhx57 UTSW 17 80,576,293 (GRCm39) missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80,577,800 (GRCm39) missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80,583,011 (GRCm39) missense probably benign
R0963:Dhx57 UTSW 17 80,582,956 (GRCm39) missense probably benign 0.01
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80,561,847 (GRCm39) missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80,553,157 (GRCm39) missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80,582,655 (GRCm39) missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80,560,514 (GRCm39) critical splice donor site probably null
R1853:Dhx57 UTSW 17 80,582,308 (GRCm39) nonsense probably null
R1942:Dhx57 UTSW 17 80,572,573 (GRCm39) missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80,560,509 (GRCm39) splice site probably benign
R2106:Dhx57 UTSW 17 80,582,792 (GRCm39) missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80,580,477 (GRCm39) missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.07
R2249:Dhx57 UTSW 17 80,588,663 (GRCm39) missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80,567,845 (GRCm39) missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80,561,733 (GRCm39) missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80,549,378 (GRCm39) splice site probably null
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2869:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2870:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2871:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R2874:Dhx57 UTSW 17 80,558,805 (GRCm39) missense probably benign 0.22
R3819:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R3964:Dhx57 UTSW 17 80,572,541 (GRCm39) nonsense probably null
R4535:Dhx57 UTSW 17 80,582,511 (GRCm39) missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80,582,390 (GRCm39) missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80,582,760 (GRCm39) missense probably benign 0.01
R4822:Dhx57 UTSW 17 80,549,596 (GRCm39) splice site probably null
R4863:Dhx57 UTSW 17 80,560,540 (GRCm39) missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80,558,827 (GRCm39) missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80,582,510 (GRCm39) missense probably damaging 1.00
R5559:Dhx57 UTSW 17 80,561,808 (GRCm39) missense possibly damaging 0.53
R5644:Dhx57 UTSW 17 80,546,302 (GRCm39) missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80,553,235 (GRCm39) missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80,571,375 (GRCm39) critical splice donor site probably null
R6177:Dhx57 UTSW 17 80,580,395 (GRCm39) missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80,582,234 (GRCm39) missense probably benign 0.00
R6802:Dhx57 UTSW 17 80,582,750 (GRCm39) missense probably benign 0.43
R6924:Dhx57 UTSW 17 80,546,244 (GRCm39) missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80,580,476 (GRCm39) missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80,575,006 (GRCm39) missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80,563,000 (GRCm39) missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80,554,542 (GRCm39) missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80,582,290 (GRCm39) missense probably benign 0.06
R7733:Dhx57 UTSW 17 80,572,503 (GRCm39) critical splice donor site probably null
R7748:Dhx57 UTSW 17 80,572,546 (GRCm39) missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80,546,287 (GRCm39) missense probably benign 0.04
R7772:Dhx57 UTSW 17 80,580,507 (GRCm39) missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80,582,585 (GRCm39) missense possibly damaging 0.82
R8370:Dhx57 UTSW 17 80,553,192 (GRCm39) missense probably damaging 1.00
R8371:Dhx57 UTSW 17 80,582,919 (GRCm39) missense probably benign 0.18
R8403:Dhx57 UTSW 17 80,585,718 (GRCm39) missense probably damaging 1.00
R8467:Dhx57 UTSW 17 80,561,853 (GRCm39) missense probably damaging 1.00
R8690:Dhx57 UTSW 17 80,577,794 (GRCm39) critical splice donor site probably benign
R9210:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9212:Dhx57 UTSW 17 80,576,338 (GRCm39) missense probably damaging 1.00
R9447:Dhx57 UTSW 17 80,549,523 (GRCm39) missense probably damaging 1.00
R9562:Dhx57 UTSW 17 80,561,817 (GRCm39) missense probably damaging 1.00
R9669:Dhx57 UTSW 17 80,553,130 (GRCm39) missense probably benign 0.09
R9717:Dhx57 UTSW 17 80,582,447 (GRCm39) missense probably damaging 1.00
Z1088:Dhx57 UTSW 17 80,558,777 (GRCm39) missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80,553,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCACTCAAGAGCAGACTTGTAGC -3'
(R):5'- ACCTGGGCTTCTAGATGATCCGAC -3'

Sequencing Primer
(F):5'- CTTGTAGCTTGTAAAGGACCACG -3'
(R):5'- tgagagggaggcaagagg -3'
Posted On 2013-06-12