Incidental Mutation 'R6113:Fkbp15'
ID484946
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62340647 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 124 (T124I)
Ref Sequence ENSEMBL: ENSMUSP00000081575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033] [ENSMUST00000107461]
Predicted Effect probably benign
Transcript: ENSMUST00000084527
AA Change: T124I

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: T124I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084528
AA Change: T124I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: T124I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098033
AA Change: T124I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151
AA Change: T124I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107461
AA Change: T124I

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103085
Gene: ENSMUSG00000066151
AA Change: T124I

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.86e-8 PROSPERO
internal_repeat_1 472 500 1.86e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131977
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,572,900 T7N probably benign Het
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dnm1l T C 16: 16,341,003 N121S probably benign Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Eml5 T A 12: 98,824,674 K1322* probably null Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Morc2b G T 17: 33,138,068 Y243* probably null Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rec8 G A 14: 55,622,478 A228T probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ATCAGAGCAGGATCCCTTCTC -3'
(R):5'- ATTCGAATTCAGTCTGGGCAG -3'

Sequencing Primer
(F):5'- ACCTCTTCCCTACACATTCCTAGGAG -3'
(R):5'- CGAATTCAGTCTGGGCAGGTTTG -3'
Posted On2017-08-16