Incidental Mutation 'R6113:Aldh1l2'
ID 484964
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 044262-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6113 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 83343998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 359 (C359*)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably null
Transcript: ENSMUST00000020497
AA Change: C472*
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: C472*

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect probably null
Transcript: ENSMUST00000146640
AA Change: C359*
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: C359*

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,390,764 (GRCm39) T7N probably benign Het
Atpsckmt T C 15: 31,608,308 (GRCm39) Y120H probably damaging Het
Bpifb6 G A 2: 153,752,651 (GRCm39) E384K probably benign Het
Chtf18 G A 17: 25,941,841 (GRCm39) R544C probably damaging Het
Cilp2 T C 8: 70,335,009 (GRCm39) D663G probably benign Het
Cplx3 T A 9: 57,509,723 (GRCm39) I92F probably damaging Het
Cr1l T C 1: 194,813,719 (GRCm39) probably benign Het
Cyp1a1 T A 9: 57,609,174 (GRCm39) F323I probably damaging Het
Dclk1 T C 3: 55,397,240 (GRCm39) Y186H probably benign Het
Dclre1c T C 2: 3,453,900 (GRCm39) L261P probably damaging Het
Dcst2 T C 3: 89,275,192 (GRCm39) S312P possibly damaging Het
Dnah17 A G 11: 118,017,101 (GRCm39) L213P probably damaging Het
Dnd1 T A 18: 36,898,448 (GRCm39) Y102F probably damaging Het
Dnm1l T C 16: 16,158,867 (GRCm39) N121S probably benign Het
Dsp T A 13: 38,376,023 (GRCm39) N1269K probably damaging Het
Dync1h1 T C 12: 110,586,848 (GRCm39) V943A probably benign Het
Eml5 T A 12: 98,790,933 (GRCm39) K1322* probably null Het
Fgf23 A G 6: 127,055,117 (GRCm39) T76A probably benign Het
Fgf6 T C 6: 126,992,900 (GRCm39) probably null Het
Fkbp15 G A 4: 62,258,884 (GRCm39) T124I probably benign Het
Gm12185 A T 11: 48,806,167 (GRCm39) H341Q possibly damaging Het
Gm20647 A G 5: 72,487,143 (GRCm39) probably benign Het
Lrp2 G C 2: 69,313,901 (GRCm39) R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 (GRCm39) T224A probably benign Het
Ly75 T G 2: 60,199,217 (GRCm39) I175L probably benign Het
Morc2b G T 17: 33,357,042 (GRCm39) Y243* probably null Het
Myo18b C G 5: 113,014,251 (GRCm39) D764H probably damaging Het
Naip6 T C 13: 100,435,794 (GRCm39) S910G possibly damaging Het
Nbeal1 T A 1: 60,261,422 (GRCm39) I21N possibly damaging Het
P3h2 A T 16: 25,799,903 (GRCm39) I430K probably benign Het
Pcdh9 A G 14: 94,124,544 (GRCm39) V542A probably damaging Het
Pkp3 T A 7: 140,662,569 (GRCm39) N60K probably damaging Het
Pold1 C A 7: 44,187,124 (GRCm39) G686C probably damaging Het
Prdm6 T A 18: 53,606,673 (GRCm39) L58Q probably damaging Het
Rab13 C A 3: 90,132,173 (GRCm39) R86S probably benign Het
Rad21l A C 2: 151,499,398 (GRCm39) L265V probably damaging Het
Rec8 G A 14: 55,859,935 (GRCm39) A228T probably damaging Het
Rgs12 C A 5: 35,177,667 (GRCm39) R76S probably damaging Het
Sfmbt1 A G 14: 30,537,141 (GRCm39) N670D possibly damaging Het
Slc17a7 A G 7: 44,824,175 (GRCm39) T464A possibly damaging Het
Srcap C A 7: 127,159,453 (GRCm39) probably benign Het
Srgap2 A T 1: 131,283,243 (GRCm39) probably null Het
Tenm1 C T X: 41,916,072 (GRCm39) G404E probably damaging Het
Thpo C A 16: 20,547,597 (GRCm39) probably benign Het
Tle4 A T 19: 14,572,952 (GRCm39) probably null Het
Tnfrsf14 T C 4: 155,008,949 (GRCm39) Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,887,182 (GRCm39) V34G probably benign Het
Trbv13-1 C T 6: 41,093,313 (GRCm39) A82V probably benign Het
Trib1 C T 15: 59,523,487 (GRCm39) R174* probably null Het
Trpv3 G A 11: 73,176,844 (GRCm39) V408I probably benign Het
Tyk2 A T 9: 21,019,218 (GRCm39) V1068E probably damaging Het
Usp35 A G 7: 96,973,533 (GRCm39) S230P probably damaging Het
Utp25 T C 1: 192,811,810 (GRCm39) I46V probably null Het
Vav1 T A 17: 57,608,884 (GRCm39) D349E probably benign Het
Vcan T A 13: 89,805,655 (GRCm39) R114* probably null Het
Vmn1r25 T C 6: 57,955,557 (GRCm39) E244G probably benign Het
Vmn2r5 T C 3: 64,398,820 (GRCm39) T720A probably benign Het
Wdr72 T A 9: 74,059,923 (GRCm39) D444E probably benign Het
Zfhx3 T A 8: 109,674,053 (GRCm39) M1701K probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83,338,389 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACAGCTATGGACCTTG -3'
(R):5'- CCAAGATCAGGTTGTTTCCATG -3'

Sequencing Primer
(F):5'- ACAGCTATGGACCTTGCCTCC -3'
(R):5'- AAGATCAGGTTGTTTCCATGTGTCTC -3'
Posted On 2017-08-16