Mutagenetix > Incidental Mutations

Incidental Mutation 'R6113:Eml5'

484968

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

044262-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.334) question?

Stock #

R6113 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 98824674 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 1322 (K1322*)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

probably null
Transcript: ENSMUST00000065716
AA Change: K1283*

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: K1283*

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000222128
AA Change: K107*

Predicted Effect

probably null
Transcript: ENSMUST00000223282
AA Change: K1322*

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abat	C	A	16: 8,572,900	T7N	probably benign	Het
Aldh1l2	G	T	10: 83,508,134	C359*	probably null	Het
Bpifb6	G	A	2: 153,910,731	E384K	probably benign	Het
Chtf18	G	A	17: 25,722,867	R544C	probably damaging	Het
Cilp2	T	C	8: 69,882,359	D663G	probably benign	Het
Cplx3	T	A	9: 57,602,440	I92F	probably damaging	Het
Cr1l	T	C	1: 195,131,411		probably benign	Het
Cyp1a1	T	A	9: 57,701,891	F323I	probably damaging	Het
Dclk1	T	C	3: 55,489,819	Y186H	probably benign	Het
Dclre1c	T	C	2: 3,452,863	L261P	probably damaging	Het
Dcst2	T	C	3: 89,367,885	S312P	possibly damaging	Het
Diexf	T	C	1: 193,129,502	I46V	probably null	Het
Dnah17	A	G	11: 118,126,275	L213P	probably damaging	Het
Dnd1	T	A	18: 36,765,395	Y102F	probably damaging	Het
Dnm1l	T	C	16: 16,341,003	N121S	probably benign	Het
Dsp	T	A	13: 38,192,047	N1269K	probably damaging	Het
Dync1h1	T	C	12: 110,620,414	V943A	probably benign	Het
Fam173b	T	C	15: 31,608,162	Y120H	probably damaging	Het
Fgf23	A	G	6: 127,078,154	T76A	probably benign	Het
Fgf6	T	C	6: 127,015,937		probably null	Het
Fkbp15	G	A	4: 62,340,647	T124I	probably benign	Het
Gm12185	A	T	11: 48,915,340	H341Q	possibly damaging	Het
Gm20647	A	G	5: 72,329,800		probably benign	Het
Lrp2	G	C	2: 69,483,557	R2277G	possibly damaging	Het
Lrrc69	T	C	4: 14,708,673	T224A	probably benign	Het
Ly75	T	G	2: 60,368,873	I175L	probably benign	Het
Morc2b	G	T	17: 33,138,068	Y243*	probably null	Het
Myo18b	C	G	5: 112,866,385	D764H	probably damaging	Het
Naip6	T	C	13: 100,299,286	S910G	possibly damaging	Het
Nbeal1	T	A	1: 60,222,263	I21N	possibly damaging	Het
P3h2	A	T	16: 25,981,153	I430K	probably benign	Het
Pcdh9	A	G	14: 93,887,108	V542A	probably damaging	Het
Pkp3	T	A	7: 141,082,656	N60K	probably damaging	Het
Pold1	C	A	7: 44,537,700	G686C	probably damaging	Het
Prdm6	T	A	18: 53,473,601	L58Q	probably damaging	Het
Rab13	C	A	3: 90,224,866	R86S	probably benign	Het
Rad21l	A	C	2: 151,657,478	L265V	probably damaging	Het
Rec8	G	A	14: 55,622,478	A228T	probably damaging	Het
Rgs12	C	A	5: 35,020,323	R76S	probably damaging	Het
Sfmbt1	A	G	14: 30,815,184	N670D	possibly damaging	Het
Slc17a7	A	G	7: 45,174,751	T464A	possibly damaging	Het
Srcap	C	A	7: 127,560,281		probably benign	Het
Srgap2	A	T	1: 131,355,505		probably null	Het
Tenm1	C	T	X: 42,827,195	G404E	probably damaging	Het
Thpo	C	A	16: 20,728,847		probably benign	Het
Tle4	A	T	19: 14,595,588		probably null	Het
Tnfrsf14	T	C	4: 154,924,492	Q74R	possibly damaging	Het
Trav15-2-dv6-2	T	G	14: 53,649,725	V34G	probably benign	Het
Trbv13-1	C	T	6: 41,116,379	A82V	probably benign	Het
Trib1	C	T	15: 59,651,638	R174*	probably null	Het
Trpv3	G	A	11: 73,286,018	V408I	probably benign	Het
Tyk2	A	T	9: 21,107,922	V1068E	probably damaging	Het
Usp35	A	G	7: 97,324,326	S230P	probably damaging	Het
Vav1	T	A	17: 57,301,884	D349E	probably benign	Het
Vcan	T	A	13: 89,657,536	R114*	probably null	Het
Vmn1r25	T	C	6: 57,978,572	E244G	probably benign	Het
Vmn2r5	T	C	3: 64,491,399	T720A	probably benign	Het
Wdr72	T	A	9: 74,152,641	D444E	probably benign	Het
Zfhx3	T	A	8: 108,947,421	M1701K	probably benign	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TTCTAACAGTGGCTCACAACTG -3'
(R):5'- TCACACTTAACAGTTGAGGGTAC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACTGCATAAATC -3'
(R):5'- CACATTTTTGTAGCTTGCAGTAATG -3'

Posted On

2017-08-16