Mutagenetix > Incidental Mutations

Incidental Mutation 'R0520:Asxl3'

48497

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

038713-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.499) question?

Stock #

R0520 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 22522986 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1351 (D1351V)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

Predicted Effect

probably damaging
Transcript: ENSMUST00000097655
AA Change: D1351V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: D1351V

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120223
AA Change: D1351V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: D1351V

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Meta Mutation Damage Score

0.0908

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	G	16: 36,253,091	I16V	probably benign	Het
Acod1	T	C	14: 103,051,516	I154T	possibly damaging	Het
Acr	G	T	15: 89,573,227	C226F	probably damaging	Het
Aff1	C	T	5: 103,847,751	R1070*	probably null	Het
Aldh9a1	C	T	1: 167,361,391		probably benign	Het
Apaf1	A	T	10: 91,079,989	H12Q	probably damaging	Het
Asic1	A	T	15: 99,695,535	I291F	probably damaging	Het
Aspm	T	A	1: 139,478,820	M1815K	possibly damaging	Het
Atg9a	C	T	1: 75,186,534	W299*	probably null	Het
B3gntl1	C	A	11: 121,623,488	V313F	possibly damaging	Het
B4galnt4	T	A	7: 141,067,373	C345*	probably null	Het
Bicc1	A	T	10: 70,957,190	F211L	probably damaging	Het
Cachd1	T	G	4: 100,897,703	V117G	probably damaging	Het
Cdc16	G	A	8: 13,760,569		probably null	Het
Cers6	C	T	2: 69,105,091	Q312*	probably null	Het
Dclre1c	A	G	2: 3,436,475	H115R	probably damaging	Het
Ddx20	T	C	3: 105,687,376	T18A	probably benign	Het
Dhx57	A	G	17: 80,258,175	V816A	possibly damaging	Het
Dlgap1	C	T	17: 70,516,994	Q325*	probably null	Het
Dnaja1	A	T	4: 40,728,072	M178L	probably benign	Het
Ecd	A	T	14: 20,328,664	S454T	probably benign	Het
Efcab6	G	A	15: 83,950,046	H454Y	probably benign	Het
Exo1	T	A	1: 175,899,465	D447E	probably benign	Het
F5	T	G	1: 164,209,587	I1965S	probably benign	Het
Fbn2	A	G	18: 58,013,749	C2692R	probably damaging	Het
Fggy	T	A	4: 95,601,103	L152Q	probably damaging	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Gm9871	A	G	6: 101,801,579		noncoding transcript	Het
Gnai2	A	T	9: 107,620,173	D7E	probably benign	Het
Gon7	C	T	12: 102,757,788		probably benign	Het
H2-K1	A	T	17: 33,997,416	V272E	probably damaging	Het
Hectd4	G	T	5: 121,331,707	R2555L	possibly damaging	Het
Hexb	T	C	13: 97,181,110	R360G	probably benign	Het
Igsf9b	C	A	9: 27,323,250	S470R	probably benign	Het
Inpp5d	T	C	1: 87,705,920		probably benign	Het
Inpp5k	C	A	11: 75,639,530	Y265*	probably null	Het
Klhl33	T	G	14: 50,891,683	E436D	probably damaging	Het
Krt80	A	G	15: 101,370,017	L13P	probably benign	Het
Krtap19-2	C	T	16: 88,873,861		probably benign	Het
March10	T	C	11: 105,389,882	T526A	probably benign	Het
Mcrs1	A	G	15: 99,248,455		probably null	Het
Msh2	G	T	17: 87,717,544	V617F	possibly damaging	Het
Nckap1	A	C	2: 80,541,530		probably benign	Het
Nek4	T	A	14: 30,959,306		probably benign	Het
Olfr1054	G	T	2: 86,333,131	T75K	probably damaging	Het
Olfr1410	T	A	1: 92,608,749	V304E	probably damaging	Het
Olfr871	G	A	9: 20,212,495	V49I	probably benign	Het
Olfr875	T	C	9: 37,773,553	V298A	probably benign	Het
Osgin1	A	G	8: 119,442,508	H48R	probably damaging	Het
Pam	T	A	1: 97,884,195	T369S	probably benign	Het
Pclo	C	T	5: 14,713,830	Q821*	probably null	Het
Plekhm1	T	C	11: 103,394,944	I222V	probably benign	Het
Ptprg	T	G	14: 12,199,783	N65K	possibly damaging	Het
Pum2	T	A	12: 8,721,710	V351E	probably damaging	Het
Slc25a54	T	A	3: 109,107,230		probably benign	Het
Smchd1	A	T	17: 71,429,543	D587E	possibly damaging	Het
Stap1	A	G	5: 86,090,964	M164V	probably benign	Het
Stat5a	T	C	11: 100,861,426	V30A	probably damaging	Het
Stk36	T	G	1: 74,602,206		probably benign	Het
Tiam1	G	T	16: 89,817,951		probably benign	Het
Tmc5	T	C	7: 118,666,576	M553T	probably damaging	Het
Tmem14a	T	A	1: 21,229,412	Y89N	possibly damaging	Het
Tpp2	A	G	1: 43,990,530	Y991C	probably damaging	Het
Ttc7	A	G	17: 87,359,151	K615E	possibly damaging	Het
Ubac2	C	T	14: 121,994,342	P227S	probably damaging	Het
Vit	A	C	17: 78,625,159	K565T	probably damaging	Het
Vps13c	T	C	9: 67,945,851	F2409L	possibly damaging	Het
Wdr64	A	G	1: 175,726,392	T173A	probably damaging	Het
Zfp759	T	C	13: 67,137,355	I60T	probably benign	Het
Zfp81	A	G	17: 33,334,377	S488P	probably damaging	Het
Zic2	CCCACCACCACCATCACCACCACCACC	CCCACCATCACCACCACCACC	14: 122,476,364		probably benign	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCAGTACACTTCTGTGCCAGCTC -3'
(R):5'- ACCGACCTAGTCTGGGAATCCAAAC -3'

Sequencing Primer
(F):5'- CCACCATTGCAAGTAATTTGCC -3'
(R):5'- TCCACTTTCAATGGAGACAGTCAG -3'

Posted On

2013-06-12