Incidental Mutation 'R6113:Abat'
ID484979
Institutional Source Beutler Lab
Gene Symbol Abat
Ensembl Gene ENSMUSG00000057880
Gene Name4-aminobutyrate aminotransferase
SynonymsGABA-T, 9630038C02Rik
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location8513429-8621568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8572900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 7 (T7N)
Ref Sequence ENSEMBL: ENSMUSP00000111504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065987] [ENSMUST00000115838] [ENSMUST00000115839] [ENSMUST00000138987]
Predicted Effect probably benign
Transcript: ENSMUST00000065987
AA Change: T7N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000063548
Gene: ENSMUSG00000057880
AA Change: T7N

DomainStartEndE-ValueType
Pfam:Aminotran_3 65 496 1.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115838
AA Change: T7N

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000111504
Gene: ENSMUSG00000057880
AA Change: T7N

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 186 5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115839
AA Change: T7N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111505
Gene: ENSMUSG00000057880
AA Change: T7N

DomainStartEndE-ValueType
Pfam:Aminotran_3 76 323 3.2e-64 PFAM
Pfam:Aminotran_3 317 390 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138987
SMART Domains Protein: ENSMUSP00000116686
Gene: ENSMUSG00000057880

DomainStartEndE-ValueType
Pfam:Aminotran_3 53 232 1.9e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140795
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: The encoded gene product is responsible for catabolism of gamma-aminobutyric acid (GABA), a mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. Deficiency of this encoded protein includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dnm1l T C 16: 16,341,003 N121S probably benign Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Eml5 T A 12: 98,824,674 K1322* probably null Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Fkbp15 G A 4: 62,340,647 T124I probably benign Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Morc2b G T 17: 33,138,068 Y243* probably null Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rec8 G A 14: 55,622,478 A228T probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Abat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Abat APN 16 8614046 missense probably benign 0.04
IGL01642:Abat APN 16 8600919 missense possibly damaging 0.81
IGL02024:Abat APN 16 8611136 missense probably damaging 1.00
IGL02071:Abat APN 16 8582812 missense probably damaging 1.00
R2853:Abat UTSW 16 8600968 missense probably damaging 1.00
R4839:Abat UTSW 16 8583648 intron probably benign
R4895:Abat UTSW 16 8615962 missense probably benign 0.00
R5378:Abat UTSW 16 8578277 missense probably benign 0.00
R5804:Abat UTSW 16 8578236 nonsense probably null
R6012:Abat UTSW 16 8582827 missense probably damaging 1.00
R6122:Abat UTSW 16 8605550 missense probably benign 0.01
R6190:Abat UTSW 16 8605608 missense probably damaging 1.00
R6328:Abat UTSW 16 8602436 intron probably benign
R6382:Abat UTSW 16 8600986 missense probably benign 0.11
R6426:Abat UTSW 16 8602436 intron probably benign
R6427:Abat UTSW 16 8602436 intron probably benign
R6428:Abat UTSW 16 8602436 intron probably benign
R6738:Abat UTSW 16 8602436 intron probably benign
R7009:Abat UTSW 16 8602367 missense probably benign 0.05
R7019:Abat UTSW 16 8618531 nonsense probably null
R7310:Abat UTSW 16 8605593 missense probably null 0.01
R7499:Abat UTSW 16 8603754 critical splice donor site probably null
R8122:Abat UTSW 16 8615897 missense probably damaging 1.00
R8138:Abat UTSW 16 8600965 missense probably benign 0.05
Z1177:Abat UTSW 16 8603753 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTCGCAAGGGAAGTTGTATCC -3'
(R):5'- TGCTACATGAGAGGTGTCCATC -3'

Sequencing Primer
(F):5'- GGAAGTTGTATCCTAAGAGTCTTCC -3'
(R):5'- GTAGCCATGGTGATAGCCTC -3'
Posted On2017-08-16