Incidental Mutation 'R6113:Dnm1l'
ID484980
Institutional Source Beutler Lab
Gene Symbol Dnm1l
Ensembl Gene ENSMUSG00000022789
Gene Namedynamin 1-like
Synonyms6330417M19Rik, python, Dnmlp1, Drp1
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location16312230-16358959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16341003 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 121 (N121S)
Ref Sequence ENSEMBL: ENSMUSP00000155605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023477] [ENSMUST00000096229] [ENSMUST00000115749] [ENSMUST00000230022] [ENSMUST00000230038] [ENSMUST00000230980]
Predicted Effect probably benign
Transcript: ENSMUST00000023477
AA Change: N121S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023477
Gene: ENSMUSG00000022789
AA Change: N121S

DomainStartEndE-ValueType
DYNc 1 255 9.83e-124 SMART
low complexity region 556 571 N/A INTRINSIC
GED 602 693 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096229
AA Change: N134S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093945
Gene: ENSMUSG00000022789
AA Change: N134S

DomainStartEndE-ValueType
DYNc 1 268 1.75e-120 SMART
low complexity region 569 584 N/A INTRINSIC
GED 615 706 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115749
SMART Domains Protein: ENSMUSP00000111415
Gene: ENSMUSG00000022789

DomainStartEndE-ValueType
DYNc 1 261 2.08e-122 SMART
low complexity region 573 588 N/A INTRINSIC
GED 619 710 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230022
AA Change: N23S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230038
AA Change: N121S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000230980
AA Change: N127S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family. The encoded protein is localized to the cytoplasm and mitochondrial membrane, is involved in mitochondrial and peroxisomal division, and is essential for mitochondrial fission. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E11.5 with internal hemorrhage and small size. Mice heterozygous for an ENU induced allele have dilated cardiomyopathy and congestive heart failure, homozygous are embryonic lethal with posterior truncation at E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,572,900 T7N probably benign Het
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Eml5 T A 12: 98,824,674 K1322* probably null Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Fkbp15 G A 4: 62,340,647 T124I probably benign Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Morc2b G T 17: 33,138,068 Y243* probably null Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rec8 G A 14: 55,622,478 A228T probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Dnm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Dnm1l APN 16 16333827 critical splice donor site probably null
IGL00696:Dnm1l APN 16 16342715 missense probably benign
IGL01146:Dnm1l APN 16 16314325 missense probably benign 0.01
IGL01385:Dnm1l APN 16 16341453 missense probably damaging 1.00
IGL01694:Dnm1l APN 16 16316651 missense probably benign 0.08
IGL02250:Dnm1l APN 16 16321686 splice site probably benign
IGL02335:Dnm1l APN 16 16342740 intron probably benign
IGL02345:Dnm1l APN 16 16329894 missense possibly damaging 0.61
IGL02403:Dnm1l APN 16 16336976 missense possibly damaging 0.78
IGL02684:Dnm1l APN 16 16321657 missense possibly damaging 0.95
IGL02869:Dnm1l APN 16 16341424 nonsense probably null
IGL03388:Dnm1l APN 16 16314052 splice site probably benign
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R1259:Dnm1l UTSW 16 16324006 missense possibly damaging 0.67
R1554:Dnm1l UTSW 16 16341426 missense probably benign 0.13
R1756:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R1913:Dnm1l UTSW 16 16329966 missense probably benign 0.45
R2906:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R2907:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R3756:Dnm1l UTSW 16 16321612 missense possibly damaging 0.86
R4226:Dnm1l UTSW 16 16314387 missense possibly damaging 0.80
R4414:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R5287:Dnm1l UTSW 16 16333868 missense probably damaging 1.00
R5574:Dnm1l UTSW 16 16329821 missense probably damaging 1.00
R5653:Dnm1l UTSW 16 16319489 missense probably damaging 1.00
R6320:Dnm1l UTSW 16 16332088 missense probably damaging 1.00
R6644:Dnm1l UTSW 16 16329873 missense probably benign 0.14
R6995:Dnm1l UTSW 16 16329807 nonsense probably null
R7309:Dnm1l UTSW 16 16321646 missense probably damaging 1.00
R7422:Dnm1l UTSW 16 16318474 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTAGCTAGCATGTACCAGGCC -3'
(R):5'- TGGTGACATCAGGCAACTTTG -3'

Sequencing Primer
(F):5'- TGTACCAGGCCCCACATTC -3'
(R):5'- GGCAACTTTGAAACAAATCTTGC -3'
Posted On2017-08-16