Incidental Mutation 'R6113:Morc2b'
ID484984
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission 044262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6113 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 33138068 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 243 (Y243*)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably null
Transcript: ENSMUST00000053896
AA Change: Y243*
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: Y243*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000131954
AA Change: Y243*
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: Y243*

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat C A 16: 8,572,900 T7N probably benign Het
Aldh1l2 G T 10: 83,508,134 C359* probably null Het
Bpifb6 G A 2: 153,910,731 E384K probably benign Het
Chtf18 G A 17: 25,722,867 R544C probably damaging Het
Cilp2 T C 8: 69,882,359 D663G probably benign Het
Cplx3 T A 9: 57,602,440 I92F probably damaging Het
Cr1l T C 1: 195,131,411 probably benign Het
Cyp1a1 T A 9: 57,701,891 F323I probably damaging Het
Dclk1 T C 3: 55,489,819 Y186H probably benign Het
Dclre1c T C 2: 3,452,863 L261P probably damaging Het
Dcst2 T C 3: 89,367,885 S312P possibly damaging Het
Diexf T C 1: 193,129,502 I46V probably null Het
Dnah17 A G 11: 118,126,275 L213P probably damaging Het
Dnd1 T A 18: 36,765,395 Y102F probably damaging Het
Dnm1l T C 16: 16,341,003 N121S probably benign Het
Dsp T A 13: 38,192,047 N1269K probably damaging Het
Dync1h1 T C 12: 110,620,414 V943A probably benign Het
Eml5 T A 12: 98,824,674 K1322* probably null Het
Fam173b T C 15: 31,608,162 Y120H probably damaging Het
Fgf23 A G 6: 127,078,154 T76A probably benign Het
Fgf6 T C 6: 127,015,937 probably null Het
Fkbp15 G A 4: 62,340,647 T124I probably benign Het
Gm12185 A T 11: 48,915,340 H341Q possibly damaging Het
Gm20647 A G 5: 72,329,800 probably benign Het
Lrp2 G C 2: 69,483,557 R2277G possibly damaging Het
Lrrc69 T C 4: 14,708,673 T224A probably benign Het
Ly75 T G 2: 60,368,873 I175L probably benign Het
Myo18b C G 5: 112,866,385 D764H probably damaging Het
Naip6 T C 13: 100,299,286 S910G possibly damaging Het
Nbeal1 T A 1: 60,222,263 I21N possibly damaging Het
P3h2 A T 16: 25,981,153 I430K probably benign Het
Pcdh9 A G 14: 93,887,108 V542A probably damaging Het
Pkp3 T A 7: 141,082,656 N60K probably damaging Het
Pold1 C A 7: 44,537,700 G686C probably damaging Het
Prdm6 T A 18: 53,473,601 L58Q probably damaging Het
Rab13 C A 3: 90,224,866 R86S probably benign Het
Rad21l A C 2: 151,657,478 L265V probably damaging Het
Rec8 G A 14: 55,622,478 A228T probably damaging Het
Rgs12 C A 5: 35,020,323 R76S probably damaging Het
Sfmbt1 A G 14: 30,815,184 N670D possibly damaging Het
Slc17a7 A G 7: 45,174,751 T464A possibly damaging Het
Srcap C A 7: 127,560,281 probably benign Het
Srgap2 A T 1: 131,355,505 probably null Het
Tenm1 C T X: 42,827,195 G404E probably damaging Het
Thpo C A 16: 20,728,847 probably benign Het
Tle4 A T 19: 14,595,588 probably null Het
Tnfrsf14 T C 4: 154,924,492 Q74R possibly damaging Het
Trav15-2-dv6-2 T G 14: 53,649,725 V34G probably benign Het
Trbv13-1 C T 6: 41,116,379 A82V probably benign Het
Trib1 C T 15: 59,651,638 R174* probably null Het
Trpv3 G A 11: 73,286,018 V408I probably benign Het
Tyk2 A T 9: 21,107,922 V1068E probably damaging Het
Usp35 A G 7: 97,324,326 S230P probably damaging Het
Vav1 T A 17: 57,301,884 D349E probably benign Het
Vcan T A 13: 89,657,536 R114* probably null Het
Vmn1r25 T C 6: 57,978,572 E244G probably benign Het
Vmn2r5 T C 3: 64,491,399 T720A probably benign Het
Wdr72 T A 9: 74,152,641 D444E probably benign Het
Zfhx3 T A 8: 108,947,421 M1701K probably benign Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AATGTACGGGCTTTGCTCTC -3'
(R):5'- GAAGTGATGACCCAGTTTACAAAG -3'

Sequencing Primer
(F):5'- CTTCCGCGAGCTGTGCTAC -3'
(R):5'- AGATTTCTGGGACTAGTGGAACCC -3'
Posted On2017-08-16