Incidental Mutation 'R6114:Cacnb2'
ID484991
Institutional Source Beutler Lab
Gene Symbol Cacnb2
Ensembl Gene ENSMUSG00000057914
Gene Namecalcium channel, voltage-dependent, beta 2 subunit
SynonymsCchb2, Cavbeta2
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location14603088-14987908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14975201 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 285 (H285L)
Ref Sequence ENSEMBL: ENSMUSP00000141221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114718
SMART Domains Protein: ENSMUSP00000110366
Gene: ENSMUSG00000057914

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 24 65 5.9e-28 PFAM
SH3 69 133 2.42e-2 SMART
low complexity region 149 161 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114719
AA Change: H291L

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: H291L

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 24 65 1.7e-26 PFAM
SH3 69 133 2.42e-2 SMART
low complexity region 149 161 N/A INTRINSIC
GuKc 232 414 6.11e-38 SMART
low complexity region 419 448 N/A INTRINSIC
low complexity region 546 561 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114723
AA Change: H335L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: H335L

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 68 109 2.7e-25 PFAM
SH3 113 177 2.42e-2 SMART
low complexity region 193 205 N/A INTRINSIC
GuKc 276 458 6.11e-38 SMART
low complexity region 463 492 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193452
Predicted Effect unknown
Transcript: ENSMUST00000193522
AA Change: H108L
Predicted Effect possibly damaging
Transcript: ENSMUST00000193800
AA Change: H285L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: H285L

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 18 59 3.2e-27 PFAM
SH3 63 127 2.42e-2 SMART
low complexity region 143 155 N/A INTRINSIC
GuKc 226 408 6.11e-38 SMART
low complexity region 413 442 N/A INTRINSIC
low complexity region 540 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Cacnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cacnb2 APN 2 14984270 missense possibly damaging 0.95
IGL01806:Cacnb2 APN 2 14614268 missense probably damaging 1.00
IGL01939:Cacnb2 APN 2 14971569 missense probably benign 0.16
IGL02941:Cacnb2 APN 2 14958829 missense probably benign 0.00
PIT1430001:Cacnb2 UTSW 2 14971601 nonsense probably null
PIT4498001:Cacnb2 UTSW 2 14874819 nonsense probably null
PIT4508001:Cacnb2 UTSW 2 14984419 missense probably benign 0.00
R0095:Cacnb2 UTSW 2 14958775 missense probably damaging 1.00
R0731:Cacnb2 UTSW 2 14985706 missense possibly damaging 0.95
R1521:Cacnb2 UTSW 2 14614352 missense probably benign 0.18
R1829:Cacnb2 UTSW 2 14985964 missense possibly damaging 0.89
R2174:Cacnb2 UTSW 2 14958767 missense probably benign 0.21
R2471:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R2473:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R3801:Cacnb2 UTSW 2 14824263 missense possibly damaging 0.85
R3831:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3832:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3833:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3981:Cacnb2 UTSW 2 14604503 missense probably benign
R4231:Cacnb2 UTSW 2 14981440 missense probably damaging 1.00
R4426:Cacnb2 UTSW 2 14975215 nonsense probably null
R4569:Cacnb2 UTSW 2 14986000 missense possibly damaging 0.94
R4815:Cacnb2 UTSW 2 14874780 missense probably damaging 1.00
R4911:Cacnb2 UTSW 2 14981340 missense possibly damaging 0.83
R5189:Cacnb2 UTSW 2 14986038 missense possibly damaging 0.56
R6158:Cacnb2 UTSW 2 14985601 missense possibly damaging 0.62
R6530:Cacnb2 UTSW 2 14975167 missense probably damaging 1.00
R6612:Cacnb2 UTSW 2 14975149 missense probably benign 0.41
R6882:Cacnb2 UTSW 2 14824299 missense probably benign 0.00
R6889:Cacnb2 UTSW 2 14986015 missense possibly damaging 0.55
R7804:Cacnb2 UTSW 2 14968037 missense probably benign 0.08
R7820:Cacnb2 UTSW 2 14960666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTAGGCAAGACAGGTGC -3'
(R):5'- ATCCCAGTAACTACACTAGCTGTTG -3'

Sequencing Primer
(F):5'- GGATCCCCTGCAACTGGAATTATAG -3'
(R):5'- ACTACACTAGCTGTTGACATGG -3'
Posted On2017-08-16