Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Cacnb2'

484991

Institutional Source

Beutler Lab

Gene Symbol

Cacnb2

Ensembl Gene

ENSMUSG00000057914

Gene Name

calcium channel, voltage-dependent, beta 2 subunit

Synonyms

Cchb2, Cavbeta2

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14603088-14987908 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14975201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 285 (H285L)

Ref Sequence

ENSEMBL: ENSMUSP00000141221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]

AlphaFold

Q8CC27

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114718

SMART Domains

Protein: ENSMUSP00000110366
Gene: ENSMUSG00000057914

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	24	65	5.9e-28	PFAM
SH3	69	133	2.42e-2	SMART
low complexity region	149	161	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114719
AA Change: H291L

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: H291L

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	24	65	1.7e-26	PFAM
SH3	69	133	2.42e-2	SMART
low complexity region	149	161	N/A	INTRINSIC
GuKc	232	414	6.11e-38	SMART
low complexity region	419	448	N/A	INTRINSIC
low complexity region	546	561	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114723
AA Change: H335L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: H335L

Domain	Start	End	E-Value	Type
low complexity region	50	61	N/A	INTRINSIC
Pfam:VGCC_beta4Aa_N	68	109	2.7e-25	PFAM
SH3	113	177	2.42e-2	SMART
low complexity region	193	205	N/A	INTRINSIC
GuKc	276	458	6.11e-38	SMART
low complexity region	463	492	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193262

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193452

Predicted Effect

unknown
Transcript: ENSMUST00000193522
AA Change: H108L

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193800
AA Change: H285L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: H285L

Domain	Start	End	E-Value	Type
Pfam:VGCC_beta4Aa_N	18	59	3.2e-27	PFAM
SH3	63	127	2.42e-2	SMART
low complexity region	143	155	N/A	INTRINSIC
GuKc	226	408	6.11e-38	SMART
low complexity region	413	442	N/A	INTRINSIC
low complexity region	540	555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194921

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Cacnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01527:Cacnb2	APN	2	14984270	missense	possibly damaging	0.95
IGL01806:Cacnb2	APN	2	14614268	missense	probably damaging	1.00
IGL01939:Cacnb2	APN	2	14971569	missense	probably benign	0.16
IGL02941:Cacnb2	APN	2	14958829	missense	probably benign	0.00
PIT1430001:Cacnb2	UTSW	2	14971601	nonsense	probably null
PIT4498001:Cacnb2	UTSW	2	14874819	nonsense	probably null
PIT4508001:Cacnb2	UTSW	2	14984419	missense	probably benign	0.00
R0095:Cacnb2	UTSW	2	14958775	missense	probably damaging	1.00
R0731:Cacnb2	UTSW	2	14985706	missense	possibly damaging	0.95
R1521:Cacnb2	UTSW	2	14614352	missense	probably benign	0.18
R1829:Cacnb2	UTSW	2	14985964	missense	possibly damaging	0.89
R2174:Cacnb2	UTSW	2	14958767	missense	probably benign	0.21
R2471:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R2473:Cacnb2	UTSW	2	14984314	missense	probably damaging	1.00
R3801:Cacnb2	UTSW	2	14824263	missense	possibly damaging	0.85
R3831:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3832:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3833:Cacnb2	UTSW	2	14981425	missense	probably damaging	1.00
R3981:Cacnb2	UTSW	2	14604503	missense	probably benign
R4231:Cacnb2	UTSW	2	14981440	missense	probably damaging	1.00
R4426:Cacnb2	UTSW	2	14975215	nonsense	probably null
R4569:Cacnb2	UTSW	2	14986000	missense	possibly damaging	0.94
R4815:Cacnb2	UTSW	2	14874780	missense	probably damaging	1.00
R4911:Cacnb2	UTSW	2	14981340	missense	possibly damaging	0.83
R5189:Cacnb2	UTSW	2	14986038	missense	possibly damaging	0.56
R6158:Cacnb2	UTSW	2	14985601	missense	possibly damaging	0.62
R6530:Cacnb2	UTSW	2	14975167	missense	probably damaging	1.00
R6612:Cacnb2	UTSW	2	14975149	missense	probably benign	0.41
R6882:Cacnb2	UTSW	2	14824299	missense	probably benign	0.00
R6889:Cacnb2	UTSW	2	14986015	missense	possibly damaging	0.55
R7804:Cacnb2	UTSW	2	14968037	missense	probably benign	0.08
R7820:Cacnb2	UTSW	2	14960666	missense	probably damaging	1.00
R7971:Cacnb2	UTSW	2	14971598	missense	possibly damaging	0.51
R7980:Cacnb2	UTSW	2	14604515	missense	probably benign
R7993:Cacnb2	UTSW	2	14963920	missense	probably benign	0.16
R8762:Cacnb2	UTSW	2	14967948	missense	possibly damaging	0.71
R8868:Cacnb2	UTSW	2	14984269	missense	probably benign	0.41
R9147:Cacnb2	UTSW	2	14967962	missense	possibly damaging	0.89
R9148:Cacnb2	UTSW	2	14967962	missense	possibly damaging	0.89
R9211:Cacnb2	UTSW	2	14874497	missense	unknown
R9521:Cacnb2	UTSW	2	14604327	start gained	probably benign
R9773:Cacnb2	UTSW	2	14971641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTAGGCAAGACAGGTGC -3'
(R):5'- ATCCCAGTAACTACACTAGCTGTTG -3'

Sequencing Primer
(F):5'- GGATCCCCTGCAACTGGAATTATAG -3'
(R):5'- ACTACACTAGCTGTTGACATGG -3'

Posted On

2017-08-16