Incidental Mutation 'R6114:Hoxd9'
ID484993
Institutional Source Beutler Lab
Gene Symbol Hoxd9
Ensembl Gene ENSMUSG00000043342
Gene Namehomeobox D9
SynonymsHox-5.2, Hox-4.4
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location74697727-74700208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74699365 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 322 (N322D)
Ref Sequence ENSEMBL: ENSMUSP00000058490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059272] [ENSMUST00000061745]
Predicted Effect probably damaging
Transcript: ENSMUST00000059272
AA Change: N322D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058490
Gene: ENSMUSG00000043342
AA Change: N322D

DomainStartEndE-ValueType
Pfam:Hox9_act 1 126 2e-47 PFAM
low complexity region 155 176 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
low complexity region 248 256 N/A INTRINSIC
HOX 272 334 6.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061745
SMART Domains Protein: ENSMUSP00000062412
Gene: ENSMUSG00000050368

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
HOX 266 328 3.3e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126966
SMART Domains Protein: ENSMUSP00000133930
Gene: ENSMUSG00000086077

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The exact role of this gene has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit anterior transformation of lumbar, sacral, and caudal vertebrae with abnormal humerus morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Hoxd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0723:Hoxd9 UTSW 2 74698828 missense probably damaging 1.00
R3743:Hoxd9 UTSW 2 74698366 missense probably damaging 0.99
R4155:Hoxd9 UTSW 2 74699323 missense probably benign 0.15
R4261:Hoxd9 UTSW 2 74695687 unclassified probably benign
R5794:Hoxd9 UTSW 2 74699273 missense probably damaging 1.00
R6197:Hoxd9 UTSW 2 74698822 missense probably damaging 0.99
R6248:Hoxd9 UTSW 2 74698636 missense probably benign 0.09
R6268:Hoxd9 UTSW 2 74698089 missense probably damaging 1.00
R6717:Hoxd9 UTSW 2 74698389 missense probably benign 0.01
R6809:Hoxd9 UTSW 2 74699246 missense probably damaging 1.00
R7183:Hoxd9 UTSW 2 74698365 missense possibly damaging 0.59
R7254:Hoxd9 UTSW 2 74698374 missense probably damaging 1.00
Z1176:Hoxd9 UTSW 2 74698128 missense probably damaging 0.99
Z1177:Hoxd9 UTSW 2 74698525 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTCCTAGACAACCCTGCAGC -3'
(R):5'- GCGAGCAAATACAGTGTCCC -3'

Sequencing Primer
(F):5'- TGCAGCGAACTGGATCCAC -3'
(R):5'- TCCGAGTCGCTGCAGAGTTTC -3'
Posted On2017-08-16