Incidental Mutation 'R6114:Sycp2'
List |< first << previous [record 52 of 64] next >> last >|
ID484996
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 178348245 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1403 (R1403G)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect probably benign
Transcript: ENSMUST00000081134
AA Change: R1403G

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: R1403G

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1413:Sycp2 UTSW 2 178347797 missense probably benign 0.00
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
R7960:Sycp2 UTSW 2 178404660 missense probably null 0.90
R8022:Sycp2 UTSW 2 178355062 missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178374585 missense probably benign 0.05
R8159:Sycp2 UTSW 2 178354977 missense probably damaging 0.97
R8233:Sycp2 UTSW 2 178356634 missense probably damaging 1.00
R8436:Sycp2 UTSW 2 178362968 missense probably benign 0.44
R8437:Sycp2 UTSW 2 178364858 missense probably damaging 1.00
R8528:Sycp2 UTSW 2 178374533 missense probably damaging 1.00
R8679:Sycp2 UTSW 2 178350975 missense probably damaging 0.99
R8711:Sycp2 UTSW 2 178348295 missense probably benign 0.41
R8843:Sycp2 UTSW 2 178348259 missense probably damaging 0.99
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Z1176:Sycp2 UTSW 2 178364881 missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178380875 missense probably damaging 1.00
Z1191:Sycp2 UTSW 2 178350869 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGAGTTCATTTGCAGCTGATG -3'
(R):5'- AACATCTGATGGCAATGACCTCTC -3'

Sequencing Primer
(F):5'- CAGCTGATGTAAGATAGAACTATGC -3'
(R):5'- TGATGGCAATGACCTCTCAAGCTC -3'
Posted On2017-08-16