Incidental Mutation 'R6114:Mfn1'
ID484997
Institutional Source Beutler Lab
Gene Symbol Mfn1
Ensembl Gene ENSMUSG00000027668
Gene Namemitofusin 1
Synonyms6330416C07Rik, HR2, D3Ertd265e, 2310002F04Rik
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32529465-32579239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 32563836 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 106 (A106D)
Ref Sequence ENSEMBL: ENSMUSP00000120960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091257] [ENSMUST00000118286] [ENSMUST00000151320]
Predicted Effect probably benign
Transcript: ENSMUST00000091257
AA Change: A458D

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000088801
Gene: ENSMUSG00000027668
AA Change: A458D

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.7e-6 PFAM
Pfam:Dynamin_N 78 238 3.9e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 575 735 1.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118286
AA Change: A458D

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113251
Gene: ENSMUSG00000027668
AA Change: A458D

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.2e-6 PFAM
Pfam:Dynamin_N 78 238 5e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 567 737 6.3e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140328
Predicted Effect probably damaging
Transcript: ENSMUST00000151320
AA Change: A106D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120960
Gene: ENSMUSG00000027668
AA Change: A106D

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Fzo_mitofusin 215 319 1.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194384
Meta Mutation Damage Score 0.2834 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Mfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mfn1 APN 3 32542836 missense probably damaging 1.00
IGL01687:Mfn1 APN 3 32563366 splice site probably benign
IGL02743:Mfn1 APN 3 32574290 missense probably benign 0.10
PIT4520001:Mfn1 UTSW 3 32561546 missense probably benign
R0039:Mfn1 UTSW 3 32538267 splice site probably benign
R0571:Mfn1 UTSW 3 32561472 missense probably damaging 1.00
R0920:Mfn1 UTSW 3 32534236 critical splice acceptor site probably null
R1661:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R1665:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R2153:Mfn1 UTSW 3 32542826 missense probably damaging 1.00
R2156:Mfn1 UTSW 3 32534251 missense possibly damaging 0.60
R2260:Mfn1 UTSW 3 32563426 nonsense probably null
R2420:Mfn1 UTSW 3 32569515 missense probably benign 0.21
R3864:Mfn1 UTSW 3 32563092 missense possibly damaging 0.89
R4079:Mfn1 UTSW 3 32542849 missense probably damaging 1.00
R4162:Mfn1 UTSW 3 32562998 splice site probably benign
R4897:Mfn1 UTSW 3 32546562 intron probably benign
R5115:Mfn1 UTSW 3 32564307 critical splice donor site probably null
R5276:Mfn1 UTSW 3 32564205 missense probably benign 0.39
R5590:Mfn1 UTSW 3 32563847 missense probably benign 0.00
R5629:Mfn1 UTSW 3 32561510 missense possibly damaging 0.83
R6110:Mfn1 UTSW 3 32563024 missense probably benign 0.01
R6560:Mfn1 UTSW 3 32569516 missense probably damaging 0.96
R6891:Mfn1 UTSW 3 32577103 missense possibly damaging 0.49
R7053:Mfn1 UTSW 3 32531965 missense probably benign 0.00
R7071:Mfn1 UTSW 3 32568395 missense probably benign 0.00
R7182:Mfn1 UTSW 3 32564220 missense probably damaging 1.00
Z1177:Mfn1 UTSW 3 32564291 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACACTGTCTGACATGTG -3'
(R):5'- TTGCCTTCCAAACAATGCAC -3'

Sequencing Primer
(F):5'- GCACACTGTCTGACATGTGACATTG -3'
(R):5'- CAATGCACCCAAATTAAAATAACCC -3'
Posted On2017-08-16