Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Itga10'

484999

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96649035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 162 (C162F)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000165842]

AlphaFold

E9Q6R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: C162F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: C162F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000048766

SMART Domains

Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	1.9e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118557

SMART Domains

Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	8.3e-77	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: C162F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: C162F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144962

Predicted Effect

probably benign
Transcript: ENSMUST00000165842

SMART Domains

Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	3	237	8.9e-69	PFAM

Meta Mutation Damage Score

0.4248

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTTCCATAGCACAGGGTAGTG -3'
(R):5'- CAAGGGTCCAGGAGTGTTTAC -3'

Sequencing Primer
(F):5'- ACAGGGTAGTGGTAGGCCTCTC -3'
(R):5'- GAGTGTTTACTTCTTTCCCTCCAATC -3'

Posted On

2017-08-16