Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Ank2'

485001

Institutional Source

Beutler Lab

Gene Symbol

Ank2

Ensembl Gene

ENSMUSG00000032826

Gene Name

ankyrin 2, brain

Synonyms

Ankyrin-B, Ank-2, Ankyrin-2, Gm4392, ankyrin B

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126921612-127499350 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127011051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 607 (N607D)

Ref Sequence

ENSEMBL: ENSMUSP00000138251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182064] [ENSMUST00000182078] [ENSMUST00000182711] [ENSMUST00000182959]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000182064
AA Change: N628D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000138620
Gene: ENSMUSG00000032826
AA Change: N628D

Domain	Start	End	E-Value	Type
ANK	9	38	1e1	SMART
ANK	42	71	8.9e-7	SMART
ANK	75	104	4.4e-9	SMART
ANK	108	137	2.8e-9	SMART
ANK	141	169	5.3e-1	SMART
ANK	170	199	7.3e-1	SMART
ANK	211	240	1.1e-7	SMART
ANK	244	273	4.4e-9	SMART
ANK	277	306	9.3e-8	SMART
ANK	310	339	2.1e-8	SMART
ANK	343	372	1.3e-7	SMART
ANK	376	405	6.2e-9	SMART
ANK	409	438	1.1e-7	SMART
ANK	442	471	2.9e-8	SMART
ANK	475	504	1.1e-5	SMART
ANK	508	537	6.5e-6	SMART
ANK	541	570	2.3e-7	SMART
ANK	574	603	2.4e-7	SMART
ANK	607	636	3.2e-9	SMART
ANK	640	669	5.5e-5	SMART
ANK	673	702	1.9e-8	SMART
ANK	706	735	3.3e-9	SMART
low complexity region	755	775	N/A	INTRINSIC
low complexity region	793	806	N/A	INTRINSIC
low complexity region	841	853	N/A	INTRINSIC
ZU5	912	1016	2e-63	SMART
low complexity region	1371	1381	N/A	INTRINSIC
low complexity region	1448	1463	N/A	INTRINSIC
low complexity region	1490	1503	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000182078
AA Change: N574D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000138753
Gene: ENSMUSG00000032826
AA Change: N574D

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
low complexity region	114	125	N/A	INTRINSIC
low complexity region	191	209	N/A	INTRINSIC
low complexity region	304	312	N/A	INTRINSIC
low complexity region	478	493	N/A	INTRINSIC
low complexity region	527	544	N/A	INTRINSIC
DEATH	591	685	1e-29	SMART
low complexity region	720	736	N/A	INTRINSIC
low complexity region	848	861	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182711
AA Change: N624D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138781
Gene: ENSMUSG00000032826
AA Change: N624D

Domain	Start	End	E-Value	Type
ANK	26	55	1e1	SMART
ANK	59	88	8.9e-7	SMART
ANK	92	121	4.4e-9	SMART
ANK	125	154	2.8e-9	SMART
ANK	158	186	5.3e-1	SMART
ANK	187	216	7.3e-1	SMART
ANK	228	257	1.1e-7	SMART
ANK	261	290	4.4e-9	SMART
ANK	294	323	9.3e-8	SMART
ANK	327	356	2.1e-8	SMART
ANK	360	389	1.3e-7	SMART
ANK	393	422	6.2e-9	SMART
ANK	426	455	1.1e-7	SMART
ANK	459	488	2.9e-8	SMART
ANK	492	521	1.1e-5	SMART
ANK	525	554	6.5e-6	SMART
ANK	558	587	2.3e-7	SMART
ANK	591	620	5.3e-7	SMART
ANK	624	653	2.4e-7	SMART
ANK	657	686	3.2e-9	SMART
ANK	690	719	5.5e-5	SMART
ANK	723	752	1.9e-8	SMART
ANK	756	785	3.3e-9	SMART
low complexity region	805	825	N/A	INTRINSIC
low complexity region	843	856	N/A	INTRINSIC
ZU5	961	1098	1.1e-50	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000182959
AA Change: N607D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138251
Gene: ENSMUSG00000032826
AA Change: N607D

Domain	Start	End	E-Value	Type
ANK	9	38	1.63e3	SMART
ANK	42	71	1.4e-4	SMART
ANK	75	104	6.76e-7	SMART
ANK	108	137	4.46e-7	SMART
ANK	141	169	8.36e1	SMART
ANK	170	199	1.17e2	SMART
ANK	211	240	1.76e-5	SMART
ANK	244	273	6.76e-7	SMART
ANK	277	306	1.43e-5	SMART
ANK	310	339	3.33e-6	SMART
ANK	343	372	2.02e-5	SMART
ANK	376	405	9.55e-7	SMART
ANK	409	438	1.76e-5	SMART
ANK	442	471	4.71e-6	SMART
ANK	475	504	1.7e-3	SMART
ANK	508	537	1.05e-3	SMART
ANK	541	570	3.51e-5	SMART
ANK	574	603	8.65e-5	SMART
ANK	607	636	3.76e-5	SMART
ANK	640	669	5.12e-7	SMART
ANK	673	702	8.39e-3	SMART
ANK	706	735	2.9e-6	SMART
ANK	739	768	5.12e-7	SMART
low complexity region	788	808	N/A	INTRINSIC
low complexity region	826	839	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
Pfam:ZU5	945	1028	1.5e-30	PFAM
Pfam:ZU5	1021	1082	4.4e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183097

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199027

Meta Mutation Damage Score

0.1617

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

PHENOTYPE: Homozygous mutation of this gene results in death by postnatal day 8, although some animals survive to P20. Mutant animals display reduced body size, impaired balance and locomotion, brain structure dysmorphologies, abnormal lens, and optic nerve degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Ank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Ank2	APN	3	126959720	missense	possibly damaging	0.80
IGL01652:Ank2	APN	3	126933041	missense	probably benign	0.00
IGL01969:Ank2	APN	3	126953223	missense	possibly damaging	0.47
IGL02122:Ank2	APN	3	126937874	splice site	probably benign
IGL02537:Ank2	APN	3	126955916	missense	probably damaging	1.00
IGL02858:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL02981:Ank2	APN	3	126934562	missense	possibly damaging	0.58
IGL02981:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03024:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03074:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03111:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03129:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03174:Ank2	APN	3	126940095	missense	probably damaging	0.98
IGL03177:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03185:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03188:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03242:Ank2	APN	3	126928805	missense	possibly damaging	0.90
IGL03244:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03248:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03285:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03304:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03358:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03380:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03389:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03400:Ank2	APN	3	126955870	missense	probably damaging	1.00
IGL03409:Ank2	APN	3	126955870	missense	probably damaging	1.00
ballast	UTSW	3	126943133	missense	unknown
Chain	UTSW	3	126946938	intron	probably benign
Deadman	UTSW	3	126929822	missense	probably benign	0.19
drag	UTSW	3	127003982	missense	probably damaging	1.00
mooring	UTSW	3	126934577	missense	possibly damaging	0.73
Treasure	UTSW	3	126946749	missense	unknown
Windlass	UTSW	3	126946149	missense	probably benign
R0033:Ank2	UTSW	3	127104748	splice site	probably benign
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0042:Ank2	UTSW	3	126936631	missense	probably damaging	0.99
R0079:Ank2	UTSW	3	126934615	missense	probably benign	0.01
R0423:Ank2	UTSW	3	126929860	nonsense	probably null
R0699:Ank2	UTSW	3	126929829	missense	probably benign	0.00
R0724:Ank2	UTSW	3	126962337	missense	probably damaging	1.00
R0990:Ank2	UTSW	3	126934666	missense	possibly damaging	0.64
R1450:Ank2	UTSW	3	126957302	missense	possibly damaging	0.94
R1500:Ank2	UTSW	3	126932982	missense	probably benign
R1702:Ank2	UTSW	3	126955899	missense	probably benign	0.00
R1703:Ank2	UTSW	3	126929766	missense	probably damaging	1.00
R1710:Ank2	UTSW	3	126933060	nonsense	probably null
R1743:Ank2	UTSW	3	126928675	missense	probably damaging	0.99
R1775:Ank2	UTSW	3	126934547	missense	probably benign	0.00
R1852:Ank2	UTSW	3	126997851	critical splice donor site	probably null
R2198:Ank2	UTSW	3	126934577	missense	possibly damaging	0.73
R2892:Ank2	UTSW	3	127248243	splice site	probably null
R2893:Ank2	UTSW	3	127248243	splice site	probably null
R2894:Ank2	UTSW	3	127248243	splice site	probably null
R3148:Ank2	UTSW	3	126933075	missense	probably benign	0.00
R3776:Ank2	UTSW	3	126942262	intron	probably benign
R3784:Ank2	UTSW	3	126953193	missense	probably damaging	1.00
R3856:Ank2	UTSW	3	126929844	missense	probably benign	0.00
R3906:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3907:Ank2	UTSW	3	127016898	missense	probably damaging	1.00
R3953:Ank2	UTSW	3	126988160	missense	probably damaging	1.00
R3963:Ank2	UTSW	3	126934596	missense	probably benign
R4367:Ank2	UTSW	3	126946149	missense	probably benign
R4414:Ank2	UTSW	3	127225762	critical splice donor site	probably null
R4432:Ank2	UTSW	3	126947806	intron	probably benign
R4433:Ank2	UTSW	3	126947806	intron	probably benign
R4579:Ank2	UTSW	3	126958963	missense	probably damaging	1.00
R4597:Ank2	UTSW	3	126988151	missense	probably damaging	1.00
R4603:Ank2	UTSW	3	127032016	missense	probably benign	0.00
R4729:Ank2	UTSW	3	126976896	nonsense	probably null
R4815:Ank2	UTSW	3	126936761	missense	probably benign
R4826:Ank2	UTSW	3	126956001	missense	probably benign	0.35
R4871:Ank2	UTSW	3	126959795	missense	probably damaging	1.00
R4880:Ank2	UTSW	3	127046826	splice site	probably null
R4915:Ank2	UTSW	3	126942671	intron	probably benign
R4935:Ank2	UTSW	3	126956064	missense	probably damaging	1.00
R4936:Ank2	UTSW	3	126955039	missense	possibly damaging	0.94
R4937:Ank2	UTSW	3	126962401	missense	probably damaging	1.00
R4946:Ank2	UTSW	3	126941940	intron	probably benign
R4963:Ank2	UTSW	3	127032096	missense	probably benign	0.01
R4989:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5023:Ank2	UTSW	3	126941871	intron	probably benign
R5060:Ank2	UTSW	3	126945921	intron	probably benign
R5078:Ank2	UTSW	3	126942353	intron	probably benign
R5086:Ank2	UTSW	3	126947348	intron	probably benign
R5134:Ank2	UTSW	3	126963445	missense	possibly damaging	0.94
R5148:Ank2	UTSW	3	127025636	splice site	probably null
R5175:Ank2	UTSW	3	127004024	missense	probably damaging	1.00
R5275:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5295:Ank2	UTSW	3	127032183	missense	probably damaging	1.00
R5303:Ank2	UTSW	3	126945804	intron	probably benign
R5309:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5312:Ank2	UTSW	3	126959768	missense	probably damaging	0.99
R5352:Ank2	UTSW	3	127498991	utr 5 prime	probably benign
R5355:Ank2	UTSW	3	126944049	intron	probably benign
R5386:Ank2	UTSW	3	126981933	missense	probably benign	0.01
R5396:Ank2	UTSW	3	126953226	missense	probably damaging	1.00
R5518:Ank2	UTSW	3	126959699	missense	probably damaging	0.98
R5534:Ank2	UTSW	3	126947298	intron	probably benign
R5554:Ank2	UTSW	3	126998973	missense	possibly damaging	0.78
R5582:Ank2	UTSW	3	126946305	intron	probably benign
R5747:Ank2	UTSW	3	126941751	intron	probably benign
R5794:Ank2	UTSW	3	126930020	missense	probably benign	0.00
R5831:Ank2	UTSW	3	127339159	start gained	probably benign
R5925:Ank2	UTSW	3	126932963	missense	probably benign	0.18
R5954:Ank2	UTSW	3	126997861	missense	probably benign	0.34
R5956:Ank2	UTSW	3	126942688	intron	probably benign
R5986:Ank2	UTSW	3	127012686	missense	possibly damaging	0.94
R5992:Ank2	UTSW	3	126959651	critical splice donor site	probably null
R6020:Ank2	UTSW	3	126946821	intron	probably benign
R6027:Ank2	UTSW	3	126997879	missense	possibly damaging	0.92
R6049:Ank2	UTSW	3	126943020	missense	possibly damaging	0.95
R6060:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
R6124:Ank2	UTSW	3	127248151	missense	probably benign	0.31
R6156:Ank2	UTSW	3	126944237	missense	probably damaging	1.00
R6173:Ank2	UTSW	3	127052746	missense	probably damaging	1.00
R6176:Ank2	UTSW	3	126945471	missense	probably benign	0.05
R6184:Ank2	UTSW	3	126962398	missense	probably damaging	1.00
R6199:Ank2	UTSW	3	127004006	missense	probably damaging	1.00
R6241:Ank2	UTSW	3	127052748	missense	probably damaging	1.00
R6254:Ank2	UTSW	3	126941804	intron	probably benign
R6259:Ank2	UTSW	3	127016986	missense	probably benign	0.28
R6260:Ank2	UTSW	3	126943557	missense	probably benign
R6321:Ank2	UTSW	3	126946938	intron	probably benign
R6393:Ank2	UTSW	3	126929757	missense	probably damaging	1.00
R6406:Ank2	UTSW	3	127032225	missense	probably damaging	1.00
R6544:Ank2	UTSW	3	126933222	missense	probably damaging	0.99
R6583:Ank2	UTSW	3	127016964	missense	probably damaging	1.00
R6739:Ank2	UTSW	3	127079994	missense	probably damaging	1.00
R6754:Ank2	UTSW	3	127096839	intron	probably benign
R6786:Ank2	UTSW	3	126958932	missense	probably damaging	0.99
R6798:Ank2	UTSW	3	126944264	intron	probably benign
R6882:Ank2	UTSW	3	126945757	intron	probably benign
R6940:Ank2	UTSW	3	126941972	intron	probably benign
R6949:Ank2	UTSW	3	127010884	missense	probably benign	0.00
R7001:Ank2	UTSW	3	127077581	missense	probably damaging	1.00
R7033:Ank2	UTSW	3	126944850	nonsense	probably null
R7036:Ank2	UTSW	3	126946392	intron	probably benign
R7045:Ank2	UTSW	3	127012744	missense	probably damaging	1.00
R7048:Ank2	UTSW	3	127025618	missense	probably benign	0.03
R7054:Ank2	UTSW	3	126943303	intron	probably benign
R7069:Ank2	UTSW	3	126946298	intron	probably benign
R7091:Ank2	UTSW	3	127023351	missense	probably damaging	0.98
R7107:Ank2	UTSW	3	127003982	missense	probably damaging	1.00
R7175:Ank2	UTSW	3	126946941	missense	unknown
R7191:Ank2	UTSW	3	126946392	missense	unknown
R7272:Ank2	UTSW	3	126943133	missense	unknown
R7381:Ank2	UTSW	3	126936628	missense	possibly damaging	0.46
R7394:Ank2	UTSW	3	126936653	missense	possibly damaging	0.77
R7462:Ank2	UTSW	3	126943034	missense	unknown
R7490:Ank2	UTSW	3	126958889	missense	probably damaging	0.99
R7514:Ank2	UTSW	3	127025603	missense	probably benign	0.06
R7534:Ank2	UTSW	3	126934333	splice site	probably null
R7540:Ank2	UTSW	3	126988159	missense	possibly damaging	0.94
R7547:Ank2	UTSW	3	126945203	missense	unknown
R7579:Ank2	UTSW	3	126946398	missense	unknown
R7584:Ank2	UTSW	3	126946128	nonsense	probably null
R7625:Ank2	UTSW	3	127052800	missense	probably damaging	1.00
R7698:Ank2	UTSW	3	127032211	missense	probably benign	0.35
R7716:Ank2	UTSW	3	126943166	missense	unknown
R7718:Ank2	UTSW	3	126965013	missense	possibly damaging	0.88
R7722:Ank2	UTSW	3	127029302	missense	probably benign	0.01
R7738:Ank2	UTSW	3	126947622	missense
R7977:Ank2	UTSW	3	126945707	missense	unknown
R7987:Ank2	UTSW	3	126945707	missense	unknown
R8007:Ank2	UTSW	3	126936447	intron	probably benign
R8150:Ank2	UTSW	3	126947513	missense
R8161:Ank2	UTSW	3	127032129	missense
R8196:Ank2	UTSW	3	126929883	missense	probably damaging	0.99
R8248:Ank2	UTSW	3	126937785	missense	possibly damaging	0.78
R8255:Ank2	UTSW	3	126946749	missense	unknown
R8279:Ank2	UTSW	3	126933171	missense	probably benign	0.04
R8300:Ank2	UTSW	3	127010906	missense
R8716:Ank2	UTSW	3	126942839	nonsense	probably null
R8724:Ank2	UTSW	3	126943756	missense	unknown
R8765:Ank2	UTSW	3	127057082	missense	possibly damaging	0.94
R8779:Ank2	UTSW	3	126965102	missense	probably damaging	0.99
R8783:Ank2	UTSW	3	127052806	missense	probably damaging	1.00
R8785:Ank2	UTSW	3	126997921	missense	probably damaging	1.00
R8826:Ank2	UTSW	3	126947302	missense	unknown
R8872:Ank2	UTSW	3	126997876	missense	possibly damaging	0.88
R8903:Ank2	UTSW	3	127046782	missense	probably damaging	1.00
R8906:Ank2	UTSW	3	126933071	missense	probably benign	0.00
R8918:Ank2	UTSW	3	126943731	missense	unknown
R8947:Ank2	UTSW	3	126942747	intron	probably benign
R8977:Ank2	UTSW	3	126944926	missense	unknown
R8990:Ank2	UTSW	3	127048180	critical splice donor site	probably null
R8994:Ank2	UTSW	3	126929822	missense	probably benign	0.19
R9009:Ank2	UTSW	3	126934376	unclassified	probably benign
R9123:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9125:Ank2	UTSW	3	126940095	missense	probably damaging	1.00
R9130:Ank2	UTSW	3	127016916	missense
R9175:Ank2	UTSW	3	126928753	missense	possibly damaging	0.52
R9220:Ank2	UTSW	3	126943437	missense	unknown
R9225:Ank2	UTSW	3	126942462	missense	unknown
R9286:Ank2	UTSW	3	127052732	missense	probably damaging	0.99
R9325:Ank2	UTSW	3	126981855	missense	probably damaging	0.98
R9367:Ank2	UTSW	3	126945029	missense	unknown
R9385:Ank2	UTSW	3	126959717	missense	probably benign	0.00
R9391:Ank2	UTSW	3	126937745	missense	probably damaging	0.99
R9422:Ank2	UTSW	3	127096856	missense	unknown
R9536:Ank2	UTSW	3	126942382	missense	unknown
R9647:Ank2	UTSW	3	126998974	missense	possibly damaging	0.93
R9650:Ank2	UTSW	3	126942180	missense	unknown
R9666:Ank2	UTSW	3	126933189	nonsense	probably null
R9686:Ank2	UTSW	3	126946901	missense	unknown
R9730:Ank2	UTSW	3	127225844	missense
R9738:Ank2	UTSW	3	126943472	missense	unknown
R9743:Ank2	UTSW	3	126940145	missense	possibly damaging	0.81
R9747:Ank2	UTSW	3	126959018	missense	probably damaging	1.00
R9800:Ank2	UTSW	3	126946500	missense	unknown
R9803:Ank2	UTSW	3	126959077	missense	possibly damaging	0.64
RF020:Ank2	UTSW	3	126945476	missense	unknown
Z1088:Ank2	UTSW	3	127029509	missense	possibly damaging	0.45
Z1177:Ank2	UTSW	3	126944357	missense	unknown
Z1187:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1190:Ank2	UTSW	3	126955952	missense	probably damaging	1.00
Z1192:Ank2	UTSW	3	126955952	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCAGAAGCAAGGTGACC -3'
(R):5'- TCTGGGTATGGTCAGATAGAATCAC -3'

Sequencing Primer
(F):5'- TCCAGAAGCAAGGTGACCATGTC -3'
(R):5'- GCTAAGCATCTAAATTAGCTGTCAGC -3'

Posted On

2017-08-16