Incidental Mutation 'R6114:Nrd1'
ID485004
Institutional Source Beutler Lab
Gene Symbol Nrd1
Ensembl Gene ENSMUSG00000053510
Gene Namenardilysin, N-arginine dibasic convertase, NRD convertase 1
SynonymsNRD-C
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location109000655-109061777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109044585 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 617 (K617M)
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644] [ENSMUST00000125645]
Predicted Effect probably damaging
Transcript: ENSMUST00000065977
AA Change: K617M

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510
AA Change: K617M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102736
AA Change: K573M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510
AA Change: K573M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106644
AA Change: K685M

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510
AA Change: K685M

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125645
AA Change: K369M

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122808
Gene: ENSMUSG00000053510
AA Change: K369M

DomainStartEndE-ValueType
Pfam:Peptidase_M16 1 100 6.4e-27 PFAM
Pfam:Peptidase_M16_C 125 311 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150784
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Nrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrd1 APN 4 109046687 unclassified probably benign
IGL00857:Nrd1 APN 4 109054002 missense probably damaging 1.00
IGL01417:Nrd1 APN 4 109000830 utr 5 prime probably benign
IGL01457:Nrd1 APN 4 109047660 missense probably benign 0.03
IGL02112:Nrd1 APN 4 109027432 splice site probably benign
IGL02279:Nrd1 APN 4 109024194 splice site probably benign
IGL02332:Nrd1 APN 4 109000988 missense probably damaging 0.99
IGL02890:Nrd1 APN 4 109053919 missense possibly damaging 0.55
IGL03179:Nrd1 APN 4 109046691 unclassified probably benign
PIT4354001:Nrd1 UTSW 4 109054025 critical splice donor site probably null
R0551:Nrd1 UTSW 4 109047708 missense probably damaging 1.00
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1990:Nrd1 UTSW 4 109039775 nonsense probably null
R4391:Nrd1 UTSW 4 109046644 missense probably damaging 1.00
R4994:Nrd1 UTSW 4 109046612 missense probably benign
R5164:Nrd1 UTSW 4 109039717 missense probably damaging 0.99
R5229:Nrd1 UTSW 4 109049108 missense probably damaging 1.00
R5387:Nrd1 UTSW 4 109039762 missense probably damaging 1.00
R5530:Nrd1 UTSW 4 109047609 missense probably damaging 0.96
R5672:Nrd1 UTSW 4 109038045 nonsense probably null
R5990:Nrd1 UTSW 4 109019071 missense probably damaging 1.00
R6018:Nrd1 UTSW 4 109013747 missense probably benign 0.01
R6106:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6140:Nrd1 UTSW 4 109049111 missense probably damaging 0.97
R6285:Nrd1 UTSW 4 109038006 missense probably damaging 0.99
R6824:Nrd1 UTSW 4 109043425 missense probably damaging 1.00
R7019:Nrd1 UTSW 4 109028802 missense probably benign 0.33
R7353:Nrd1 UTSW 4 109039749 missense probably damaging 1.00
R7735:Nrd1 UTSW 4 109037985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGAACATCATGACACTGTAG -3'
(R):5'- TTTGTCTCCATAAGAACCACCAAAG -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCCAGGACAGCC -3'
(R):5'- TCAGCAGTAGAGAGTTCCTGC -3'
Posted On2017-08-16