Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Zbtb40'

485005

Institutional Source

Beutler Lab

Gene Symbol

Zbtb40

Ensembl Gene

ENSMUSG00000060862

Gene Name

zinc finger and BTB domain containing 40

Synonyms

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136979732-137048801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 136988691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 988 (I988F)

Ref Sequence

ENSEMBL: ENSMUSP00000061899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049583]

AlphaFold

Q6PCS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000049583
AA Change: I988F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: I988F

Domain	Start	End	E-Value	Type
low complexity region	8	14	N/A	INTRINSIC
BTB	24	117	3.39e-18	SMART
low complexity region	150	170	N/A	INTRINSIC
low complexity region	525	533	N/A	INTRINSIC
low complexity region	725	741	N/A	INTRINSIC
ZnF_C2H2	754	774	4.86e1	SMART
low complexity region	786	801	N/A	INTRINSIC
ZnF_C2H2	825	848	1.16e-1	SMART
ZnF_C2H2	854	876	1.1e-2	SMART
ZnF_C2H2	882	905	1.16e-1	SMART
ZnF_C2H2	911	933	1.2e-3	SMART
ZnF_C2H2	939	962	8.81e-2	SMART
ZnF_C2H2	969	992	7.05e-1	SMART
ZnF_C2H2	997	1019	1.47e-3	SMART
ZnF_C2H2	1025	1047	2.86e-1	SMART
ZnF_C2H2	1065	1088	6.67e-2	SMART
ZnF_C2H2	1094	1117	6.23e-2	SMART
ZnF_C2H2	1123	1146	1.53e-1	SMART
ZnF_C2H2	1154	1177	1.56e-2	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000218160
AA Change: I79F

Meta Mutation Damage Score

0.1500

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Zbtb40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zbtb40	APN	4	136987340	missense	probably damaging	0.99
IGL00573:Zbtb40	APN	4	137018078	missense	probably benign	0.00
IGL00774:Zbtb40	APN	4	136994524	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0334:Zbtb40	UTSW	4	136986556	missense	probably damaging	1.00
R0393:Zbtb40	UTSW	4	137018531	missense	probably benign	0.09
R0482:Zbtb40	UTSW	4	136983228	missense	probably damaging	1.00
R1457:Zbtb40	UTSW	4	136984837	missense	possibly damaging	0.81
R1846:Zbtb40	UTSW	4	137007839	missense	probably benign	0.00
R2153:Zbtb40	UTSW	4	136991635	missense	probably damaging	1.00
R2206:Zbtb40	UTSW	4	137017285	nonsense	probably null
R2291:Zbtb40	UTSW	4	136985017	missense	possibly damaging	0.78
R2406:Zbtb40	UTSW	4	136998568	missense	probably benign	0.34
R3707:Zbtb40	UTSW	4	136999568	missense	probably damaging	1.00
R4131:Zbtb40	UTSW	4	136995396	missense	probably benign	0.00
R4243:Zbtb40	UTSW	4	137018549	missense	probably benign	0.00
R4424:Zbtb40	UTSW	4	136998694	missense	probably damaging	0.96
R4725:Zbtb40	UTSW	4	137018761	utr 5 prime	probably benign
R4784:Zbtb40	UTSW	4	137007097	missense	probably damaging	1.00
R4795:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4796:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4838:Zbtb40	UTSW	4	137001216	missense	probably benign	0.15
R4859:Zbtb40	UTSW	4	136988759	missense	probably damaging	0.98
R4883:Zbtb40	UTSW	4	137000930	missense	probably benign	0.09
R5001:Zbtb40	UTSW	4	136996150	missense	probably damaging	1.00
R5030:Zbtb40	UTSW	4	136997952	missense	probably benign	0.00
R5060:Zbtb40	UTSW	4	137001293	missense	possibly damaging	0.71
R5529:Zbtb40	UTSW	4	136983163	missense	possibly damaging	0.90
R5536:Zbtb40	UTSW	4	136987331	missense	probably damaging	1.00
R5589:Zbtb40	UTSW	4	136995283	missense	probably damaging	1.00
R6393:Zbtb40	UTSW	4	136984866	missense	probably null
R7208:Zbtb40	UTSW	4	136999626	splice site	probably null
R7406:Zbtb40	UTSW	4	137000894	missense	probably benign	0.29
R7722:Zbtb40	UTSW	4	136991518	missense	probably damaging	0.98
R7803:Zbtb40	UTSW	4	137017327	missense	probably benign
R8292:Zbtb40	UTSW	4	136999567	missense	probably damaging	1.00
R8735:Zbtb40	UTSW	4	136998646	missense	probably damaging	1.00
R8890:Zbtb40	UTSW	4	136998586	missense	probably damaging	1.00
R9003:Zbtb40	UTSW	4	137018593	missense	probably damaging	1.00
R9290:Zbtb40	UTSW	4	137018218	missense	probably benign	0.00
R9328:Zbtb40	UTSW	4	137018309	missense	probably benign	0.00
RF014:Zbtb40	UTSW	4	137017306	missense	probably benign	0.20
Z1176:Zbtb40	UTSW	4	136995463	missense	probably damaging	1.00
Z1177:Zbtb40	UTSW	4	137018024	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGACGCGCTTGGACAACATG -3'
(R):5'- CACAAGAGGTCTGAAGAGCCTTC -3'

Sequencing Primer
(F):5'- CTTGGACAACATGCGGGCAAC -3'
(R):5'- TGAAGAGCCTTCCGTCTCGATG -3'

Posted On

2017-08-16