Incidental Mutation 'R6114:Zbtb40'
ID485005
Institutional Source Beutler Lab
Gene Symbol Zbtb40
Ensembl Gene ENSMUSG00000060862
Gene Namezinc finger and BTB domain containing 40
Synonyms
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location136979732-137048801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136988691 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 988 (I988F)
Ref Sequence ENSEMBL: ENSMUSP00000061899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049583]
Predicted Effect probably damaging
Transcript: ENSMUST00000049583
AA Change: I988F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: I988F

DomainStartEndE-ValueType
low complexity region 8 14 N/A INTRINSIC
BTB 24 117 3.39e-18 SMART
low complexity region 150 170 N/A INTRINSIC
low complexity region 525 533 N/A INTRINSIC
low complexity region 725 741 N/A INTRINSIC
ZnF_C2H2 754 774 4.86e1 SMART
low complexity region 786 801 N/A INTRINSIC
ZnF_C2H2 825 848 1.16e-1 SMART
ZnF_C2H2 854 876 1.1e-2 SMART
ZnF_C2H2 882 905 1.16e-1 SMART
ZnF_C2H2 911 933 1.2e-3 SMART
ZnF_C2H2 939 962 8.81e-2 SMART
ZnF_C2H2 969 992 7.05e-1 SMART
ZnF_C2H2 997 1019 1.47e-3 SMART
ZnF_C2H2 1025 1047 2.86e-1 SMART
ZnF_C2H2 1065 1088 6.67e-2 SMART
ZnF_C2H2 1094 1117 6.23e-2 SMART
ZnF_C2H2 1123 1146 1.53e-1 SMART
ZnF_C2H2 1154 1177 1.56e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218160
AA Change: I79F
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Zbtb40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Zbtb40 APN 4 136987340 missense probably damaging 0.99
IGL00573:Zbtb40 APN 4 137018078 missense probably benign 0.00
IGL00774:Zbtb40 APN 4 136994524 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0046:Zbtb40 UTSW 4 136987278 missense probably damaging 1.00
R0334:Zbtb40 UTSW 4 136986556 missense probably damaging 1.00
R0393:Zbtb40 UTSW 4 137018531 missense probably benign 0.09
R0482:Zbtb40 UTSW 4 136983228 missense probably damaging 1.00
R1457:Zbtb40 UTSW 4 136984837 missense possibly damaging 0.81
R1846:Zbtb40 UTSW 4 137007839 missense probably benign 0.00
R2153:Zbtb40 UTSW 4 136991635 missense probably damaging 1.00
R2206:Zbtb40 UTSW 4 137017285 nonsense probably null
R2291:Zbtb40 UTSW 4 136985017 missense possibly damaging 0.78
R2406:Zbtb40 UTSW 4 136998568 missense probably benign 0.34
R3707:Zbtb40 UTSW 4 136999568 missense probably damaging 1.00
R4131:Zbtb40 UTSW 4 136995396 missense probably benign 0.00
R4243:Zbtb40 UTSW 4 137018549 missense probably benign 0.00
R4424:Zbtb40 UTSW 4 136998694 missense probably damaging 0.96
R4725:Zbtb40 UTSW 4 137018761 utr 5 prime probably benign
R4784:Zbtb40 UTSW 4 137007097 missense probably damaging 1.00
R4795:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4796:Zbtb40 UTSW 4 136998642 missense probably benign 0.00
R4838:Zbtb40 UTSW 4 137001216 missense probably benign 0.15
R4859:Zbtb40 UTSW 4 136988759 missense probably damaging 0.98
R4883:Zbtb40 UTSW 4 137000930 missense probably benign 0.09
R5001:Zbtb40 UTSW 4 136996150 missense probably damaging 1.00
R5030:Zbtb40 UTSW 4 136997952 missense probably benign 0.00
R5060:Zbtb40 UTSW 4 137001293 missense possibly damaging 0.71
R5529:Zbtb40 UTSW 4 136983163 missense possibly damaging 0.90
R5536:Zbtb40 UTSW 4 136987331 missense probably damaging 1.00
R5589:Zbtb40 UTSW 4 136995283 missense probably damaging 1.00
R6393:Zbtb40 UTSW 4 136984866 missense probably null
R7208:Zbtb40 UTSW 4 136999626 splice site probably null
R7406:Zbtb40 UTSW 4 137000894 missense probably benign 0.29
R7722:Zbtb40 UTSW 4 136991518 missense probably damaging 0.98
R7803:Zbtb40 UTSW 4 137017327 missense probably benign
RF014:Zbtb40 UTSW 4 137017306 missense probably benign 0.20
Z1176:Zbtb40 UTSW 4 136995463 missense probably damaging 1.00
Z1177:Zbtb40 UTSW 4 137018024 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACGCGCTTGGACAACATG -3'
(R):5'- CACAAGAGGTCTGAAGAGCCTTC -3'

Sequencing Primer
(F):5'- CTTGGACAACATGCGGGCAAC -3'
(R):5'- TGAAGAGCCTTCCGTCTCGATG -3'
Posted On2017-08-16