Incidental Mutation 'R6114:Samd4b'
ID 485015
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Name sterile alpha motif domain containing 4B
Synonyms
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.524) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28098947-28135616 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 28222217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000078364]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078364
SMART Domains Protein: ENSMUSP00000077473
Gene: ENSMUSG00000060747

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:IL28A 32 189 2.2e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,809,252 (GRCm39) V237L probably benign Het
Aff1 T C 5: 103,990,163 (GRCm39) S878P probably damaging Het
Ahcy A C 2: 154,904,079 (GRCm39) L386R probably damaging Het
Ank2 T C 3: 126,804,700 (GRCm39) N607D probably damaging Het
Arid5b T C 10: 67,933,574 (GRCm39) D776G possibly damaging Het
Art4 T A 6: 136,834,211 (GRCm39) T11S unknown Het
Blm T C 7: 80,163,235 (GRCm39) T39A probably damaging Het
Cabin1 T A 10: 75,583,805 (GRCm39) M221L probably benign Het
Cacna1c T C 6: 118,573,101 (GRCm39) T1675A probably benign Het
Cacnb2 A T 2: 14,980,012 (GRCm39) H285L possibly damaging Het
Cchcr1 A G 17: 35,836,227 (GRCm39) E339G probably damaging Het
Cd14 A G 18: 36,859,006 (GRCm39) W150R probably damaging Het
Cep162 A G 9: 87,085,763 (GRCm39) I1187T probably benign Het
Cntnap4 A G 8: 113,568,385 (GRCm39) H807R probably damaging Het
Copb1 T A 7: 113,846,036 (GRCm39) H178L probably benign Het
Cpxm2 A G 7: 131,756,035 (GRCm39) V103A probably benign Het
Egfr A G 11: 16,854,374 (GRCm39) T849A possibly damaging Het
Endou T A 15: 97,611,757 (GRCm39) K294* probably null Het
Hoxd9 A G 2: 74,529,709 (GRCm39) N322D probably damaging Het
Hsph1 C A 5: 149,550,852 (GRCm39) V416L possibly damaging Het
Igkv4-78 T A 6: 69,036,743 (GRCm39) T97S possibly damaging Het
Itga10 G T 3: 96,556,351 (GRCm39) C162F probably damaging Het
Lmod2 A G 6: 24,603,691 (GRCm39) E222G probably damaging Het
Lpar5 A G 6: 125,058,639 (GRCm39) N120S probably damaging Het
Lrrc37 T A 11: 103,508,617 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,632,029 (GRCm39) I1318V probably benign Het
Lst1 T C 17: 35,407,336 (GRCm39) T11A possibly damaging Het
Mfn1 C A 3: 32,617,985 (GRCm39) A106D probably damaging Het
Ms4a12 G T 19: 11,192,654 (GRCm39) N227K probably benign Het
Nr1h4 T A 10: 89,314,678 (GRCm39) N273Y possibly damaging Het
Nrdc A T 4: 108,901,782 (GRCm39) K617M probably damaging Het
Or10a3b A T 7: 108,444,593 (GRCm39) M208K possibly damaging Het
Or1l8 A T 2: 36,817,701 (GRCm39) C142S possibly damaging Het
Or6c202 T A 10: 128,996,202 (GRCm39) H217L probably benign Het
Pcdhgc3 C G 18: 37,940,925 (GRCm39) T442R probably benign Het
Pcnx2 T C 8: 126,500,686 (GRCm39) N1468S probably damaging Het
Pde2a A T 7: 101,160,319 (GRCm39) probably null Het
Pitx2 C G 3: 128,998,062 (GRCm39) probably null Het
Reck T A 4: 43,922,895 (GRCm39) I390N probably damaging Het
Rora A G 9: 69,278,605 (GRCm39) N254S probably benign Het
Scn8a A G 15: 100,938,477 (GRCm39) T1949A probably damaging Het
Slc22a15 A T 3: 101,768,168 (GRCm39) Y346* probably null Het
Slc24a5 A G 2: 124,925,012 (GRCm39) T218A probably benign Het
Slc38a10 G A 11: 120,020,138 (GRCm39) Q305* probably null Het
Slc45a4 G A 15: 73,477,453 (GRCm39) P28S probably damaging Het
Smyd5 A T 6: 85,417,244 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,494 (GRCm39) D403G probably damaging Het
Stx7 A G 10: 24,060,883 (GRCm39) probably null Het
Svil T C 18: 5,108,639 (GRCm39) S1522P probably damaging Het
Sycp2 G C 2: 177,990,038 (GRCm39) R1403G probably benign Het
Tasor2 G A 13: 3,640,081 (GRCm39) T352M probably damaging Het
Tcf25 A T 8: 124,111,114 (GRCm39) K192M probably damaging Het
Tecpr1 C T 5: 144,141,458 (GRCm39) G804S possibly damaging Het
Teddm1a C G 1: 153,767,614 (GRCm39) S26C probably damaging Het
Usp13 C T 3: 32,908,818 (GRCm39) P155S probably damaging Het
Usp17lb T A 7: 104,489,571 (GRCm39) D451V possibly damaging Het
Vmn1r173 A G 7: 23,402,254 (GRCm39) N163S possibly damaging Het
Vmn2r103 G T 17: 20,032,587 (GRCm39) C787F probably damaging Het
Vmn2r106 G A 17: 20,488,638 (GRCm39) P587L probably benign Het
Wdr24 C T 17: 26,043,579 (GRCm39) H134Y probably benign Het
Zbtb40 T A 4: 136,716,002 (GRCm39) I988F probably damaging Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp536 A T 7: 37,179,161 (GRCm39) I84N probably damaging Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28,101,302 (GRCm39) missense probably damaging 1.00
IGL00979:Samd4b APN 7 28,113,638 (GRCm39) missense probably damaging 1.00
IGL01336:Samd4b APN 7 28,113,388 (GRCm39) missense probably benign 0.00
IGL01432:Samd4b APN 7 28,113,491 (GRCm39) missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28,101,334 (GRCm39) critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28,113,546 (GRCm39) missense probably damaging 1.00
IGL03077:Samd4b APN 7 28,105,868 (GRCm39) missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28,104,971 (GRCm39) missense possibly damaging 0.89
R0367:Samd4b UTSW 7 28,122,873 (GRCm39) missense probably damaging 1.00
R0390:Samd4b UTSW 7 28,103,402 (GRCm39) missense probably benign 0.13
R0440:Samd4b UTSW 7 28,107,585 (GRCm39) missense probably benign 0.45
R0488:Samd4b UTSW 7 28,113,662 (GRCm39) missense probably damaging 1.00
R0798:Samd4b UTSW 7 28,101,048 (GRCm39) splice site probably benign
R1233:Samd4b UTSW 7 28,113,435 (GRCm39) missense probably damaging 0.98
R1234:Samd4b UTSW 7 28,113,435 (GRCm39) missense probably damaging 0.98
R1481:Samd4b UTSW 7 28,113,435 (GRCm39) missense probably damaging 0.98
R1643:Samd4b UTSW 7 28,123,041 (GRCm39) missense probably damaging 1.00
R1675:Samd4b UTSW 7 28,113,435 (GRCm39) missense probably damaging 0.98
R1768:Samd4b UTSW 7 28,113,317 (GRCm39) missense probably benign 0.36
R1801:Samd4b UTSW 7 28,106,756 (GRCm39) splice site probably null
R2831:Samd4b UTSW 7 28,103,338 (GRCm39) missense probably damaging 0.99
R4505:Samd4b UTSW 7 28,106,925 (GRCm39) missense probably benign 0.15
R4507:Samd4b UTSW 7 28,106,925 (GRCm39) missense probably benign 0.15
R4731:Samd4b UTSW 7 28,106,088 (GRCm39) missense probably benign 0.00
R5811:Samd4b UTSW 7 28,107,445 (GRCm39) missense probably damaging 1.00
R6063:Samd4b UTSW 7 28,123,056 (GRCm39) start codon destroyed possibly damaging 0.71
R6356:Samd4b UTSW 7 28,101,018 (GRCm39) missense probably damaging 1.00
R6467:Samd4b UTSW 7 28,101,285 (GRCm39) missense probably damaging 1.00
R7055:Samd4b UTSW 7 28,103,458 (GRCm39) missense probably benign 0.01
R7191:Samd4b UTSW 7 28,113,686 (GRCm39) missense probably benign 0.18
R7371:Samd4b UTSW 7 28,122,926 (GRCm39) missense probably benign 0.33
R7445:Samd4b UTSW 7 28,105,881 (GRCm39) missense probably benign 0.00
R7543:Samd4b UTSW 7 28,113,711 (GRCm39) missense probably benign 0.02
R7663:Samd4b UTSW 7 28,122,925 (GRCm39) nonsense probably null
R7746:Samd4b UTSW 7 28,103,328 (GRCm39) missense probably damaging 1.00
R7991:Samd4b UTSW 7 28,103,458 (GRCm39) missense probably benign 0.01
R8235:Samd4b UTSW 7 28,106,031 (GRCm39) missense probably benign
R9423:Samd4b UTSW 7 28,113,633 (GRCm39) missense probably benign 0.00
R9615:Samd4b UTSW 7 28,106,714 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGACCAGGTTAAAAGCATGG -3'
(R):5'- ACTTGAACTGAGCAATGTGGC -3'

Sequencing Primer
(F):5'- CTGGAAACTCAGAGCCTCAGG -3'
(R):5'- TTGAACTGAGCAATGTGGCAATCC -3'
Posted On 2017-08-16