Incidental Mutation 'R6114:Blm'
ID485017
Institutional Source Beutler Lab
Gene Symbol Blm
Ensembl Gene ENSMUSG00000030528
Gene NameBloom syndrome, RecQ like helicase
Synonyms
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80454733-80535119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80513487 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000127995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081314] [ENSMUST00000170315]
Predicted Effect probably damaging
Transcript: ENSMUST00000081314
AA Change: T36A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080062
Gene: ENSMUSG00000030528
AA Change: T36A

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 219 231 N/A INTRINSIC
low complexity region 318 335 N/A INTRINSIC
Pfam:BDHCT 376 416 5.5e-27 PFAM
low complexity region 557 574 N/A INTRINSIC
DEXDc 672 873 1.59e-29 SMART
HELICc 910 992 1.29e-24 SMART
RQC 1084 1198 1.43e-15 SMART
HRDC 1217 1297 9.4e-20 SMART
low complexity region 1357 1371 N/A INTRINSIC
low complexity region 1378 1392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170315
AA Change: T39A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127995
Gene: ENSMUSG00000030528
AA Change: T39A

DomainStartEndE-ValueType
Pfam:BLM_N 4 375 1.1e-161 PFAM
Pfam:BDHCT 380 419 6.4e-25 PFAM
Pfam:BDHCT_assoc 433 658 8.8e-108 PFAM
DEXDc 675 876 1.59e-29 SMART
HELICc 913 995 1.29e-24 SMART
Pfam:RecQ_Zn_bind 1006 1078 1.5e-19 PFAM
RQC 1087 1201 1.43e-15 SMART
HRDC 1220 1300 9.4e-20 SMART
low complexity region 1360 1374 N/A INTRINSIC
low complexity region 1381 1395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205263
Meta Mutation Damage Score 0.0850 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. The normal protein may act to suppress inappropriate recombination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are developmentally delayed, with increased apopotosis in the epiblast and severe anemia, dying at embyronic day 13.5; but homozygotes for a cre mediated recombinant allele are viable Bloom syndrome-like mice prone to a wide variety of cancers and showing increased rates of LOH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Blm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Blm APN 7 80474071 missense probably damaging 1.00
IGL01658:Blm APN 7 80463941 missense probably damaging 0.98
IGL02048:Blm APN 7 80502961 splice site probably benign
IGL02060:Blm APN 7 80514580 splice site probably benign
IGL02063:Blm APN 7 80509419 nonsense probably null
IGL02102:Blm APN 7 80469756 missense probably damaging 1.00
IGL02420:Blm APN 7 80496006 missense probably damaging 1.00
IGL02452:Blm APN 7 80503377 splice site probably null
IGL02566:Blm APN 7 80474196 missense probably damaging 1.00
IGL03387:Blm APN 7 80494147 missense probably damaging 1.00
FR4304:Blm UTSW 7 80463773 frame shift probably null
FR4304:Blm UTSW 7 80512919 small insertion probably benign
FR4340:Blm UTSW 7 80463767 unclassified probably benign
FR4340:Blm UTSW 7 80512907 small insertion probably benign
FR4340:Blm UTSW 7 80512910 small insertion probably benign
FR4449:Blm UTSW 7 80512908 small insertion probably benign
FR4548:Blm UTSW 7 80463769 frame shift probably null
FR4589:Blm UTSW 7 80463770 frame shift probably null
FR4737:Blm UTSW 7 80463771 frame shift probably null
FR4737:Blm UTSW 7 80463774 frame shift probably null
FR4976:Blm UTSW 7 80463767 unclassified probably benign
FR4976:Blm UTSW 7 80512907 small insertion probably benign
R0133:Blm UTSW 7 80502367 missense possibly damaging 0.93
R0194:Blm UTSW 7 80464946 unclassified probably benign
R0526:Blm UTSW 7 80505893 nonsense probably null
R0673:Blm UTSW 7 80499751 critical splice donor site probably null
R0972:Blm UTSW 7 80513370 missense probably benign
R0980:Blm UTSW 7 80499958 splice site probably null
R1120:Blm UTSW 7 80481466 missense probably damaging 1.00
R1301:Blm UTSW 7 80455417 nonsense probably null
R1769:Blm UTSW 7 80513370 missense probably benign
R1866:Blm UTSW 7 80494114 missense probably benign 0.08
R1874:Blm UTSW 7 80497418 missense probably damaging 1.00
R1966:Blm UTSW 7 80513186 missense possibly damaging 0.86
R1991:Blm UTSW 7 80505949 splice site probably null
R2013:Blm UTSW 7 80502399 missense probably damaging 0.99
R2014:Blm UTSW 7 80502399 missense probably damaging 0.99
R2015:Blm UTSW 7 80502399 missense probably damaging 0.99
R2016:Blm UTSW 7 80505926 missense probably benign 0.26
R2103:Blm UTSW 7 80505949 splice site probably null
R2161:Blm UTSW 7 80481370 intron probably null
R2215:Blm UTSW 7 80499847 missense possibly damaging 0.69
R3689:Blm UTSW 7 80513079 missense possibly damaging 0.56
R4049:Blm UTSW 7 80502862 missense probably benign 0.04
R4155:Blm UTSW 7 80512904 small deletion probably benign
R4695:Blm UTSW 7 80494228 missense probably damaging 1.00
R4774:Blm UTSW 7 80463848 missense probably damaging 1.00
R4833:Blm UTSW 7 80466826 missense probably benign
R4835:Blm UTSW 7 80509546 missense probably benign 0.41
R4994:Blm UTSW 7 80458825 missense probably benign 0.00
R5039:Blm UTSW 7 80505873 missense possibly damaging 0.50
R5330:Blm UTSW 7 80458936 missense possibly damaging 0.73
R5375:Blm UTSW 7 80513229 missense probably benign 0.00
R5408:Blm UTSW 7 80502622 missense probably benign 0.01
R5574:Blm UTSW 7 80499773 missense probably damaging 1.00
R5606:Blm UTSW 7 80460832 intron probably null
R5702:Blm UTSW 7 80458927 missense probably benign 0.13
R5809:Blm UTSW 7 80464844 missense probably damaging 1.00
R6157:Blm UTSW 7 80512985 missense probably benign 0.18
R6163:Blm UTSW 7 80512904 small deletion probably benign
R6254:Blm UTSW 7 80480342 missense probably benign 0.04
R6266:Blm UTSW 7 80499940 missense probably benign 0.03
R6364:Blm UTSW 7 80494526 nonsense probably null
R6446:Blm UTSW 7 80512904 small deletion probably benign
R6502:Blm UTSW 7 80481475 missense probably damaging 0.98
R6700:Blm UTSW 7 80463850 missense possibly damaging 0.91
R7002:Blm UTSW 7 80469753 missense probably benign 0.00
R7105:Blm UTSW 7 80499768 missense probably benign 0.44
R7320:Blm UTSW 7 80455354 nonsense probably null
R7465:Blm UTSW 7 80513115 missense probably benign 0.02
R7561:Blm UTSW 7 80502528 missense probably damaging 0.99
RF001:Blm UTSW 7 80512903 small insertion probably benign
RF001:Blm UTSW 7 80512906 small insertion probably benign
RF001:Blm UTSW 7 80512927 small insertion probably benign
RF002:Blm UTSW 7 80512905 small insertion probably benign
RF002:Blm UTSW 7 80512927 small insertion probably benign
RF007:Blm UTSW 7 80512933 nonsense probably null
RF016:Blm UTSW 7 80512926 nonsense probably null
RF018:Blm UTSW 7 80512926 nonsense probably null
RF027:Blm UTSW 7 80512914 frame shift probably null
RF028:Blm UTSW 7 80512905 nonsense probably null
RF031:Blm UTSW 7 80512906 small insertion probably benign
RF031:Blm UTSW 7 80512923 small insertion probably benign
RF032:Blm UTSW 7 80512930 small insertion probably benign
RF036:Blm UTSW 7 80512914 nonsense probably null
RF044:Blm UTSW 7 80512930 small insertion probably benign
RF053:Blm UTSW 7 80512921 small insertion probably benign
RF064:Blm UTSW 7 80512923 nonsense probably null
X0061:Blm UTSW 7 80458850 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCCTTCCAGGGAAATGTTTAAAG -3'
(R):5'- CCACAGAGTGACAGATTCTATGC -3'

Sequencing Primer
(F):5'- AAAGAAGCCTTCAATCTTTGCCTGC -3'
(R):5'- ACGTGACTTGCACTTGAAATG -3'
Posted On2017-08-16