Incidental Mutation 'R6114:Pde2a'
ID485018
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Namephosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101421691-101512827 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 101511112 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000166652] [ENSMUST00000209537] [ENSMUST00000209537] [ENSMUST00000210364] [ENSMUST00000211368]
Predicted Effect probably null
Transcript: ENSMUST00000084894
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084894
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163751
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163751
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166652
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166652
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209537
Predicted Effect probably null
Transcript: ENSMUST00000209537
Predicted Effect probably benign
Transcript: ENSMUST00000210364
Predicted Effect probably null
Transcript: ENSMUST00000211368
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101484589 nonsense probably null
IGL00731:Pde2a APN 7 101508099 missense probably benign 0.04
IGL00807:Pde2a APN 7 101504412 missense probably damaging 1.00
IGL01339:Pde2a APN 7 101507159 missense probably benign
IGL01503:Pde2a APN 7 101501936 splice site probably benign
IGL01646:Pde2a APN 7 101507711 missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101504740 missense probably benign 0.40
IGL02281:Pde2a APN 7 101481392 missense probably benign 0.34
IGL02318:Pde2a APN 7 101503343 missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101501083 missense probably damaging 1.00
IGL02632:Pde2a APN 7 101504656 missense probably damaging 1.00
IGL02725:Pde2a APN 7 101507218 missense probably null 0.00
IGL02888:Pde2a APN 7 101505069 missense probably damaging 0.98
IGL03027:Pde2a APN 7 101481420 missense probably benign 0.01
IGL03114:Pde2a APN 7 101508683 splice site probably benign
PIT1430001:Pde2a UTSW 7 101451477 splice site probably benign
PIT4131001:Pde2a UTSW 7 101511154 missense probably damaging 0.98
PIT4431001:Pde2a UTSW 7 101501897 missense probably damaging 1.00
R1170:Pde2a UTSW 7 101484543 missense probably benign 0.00
R1298:Pde2a UTSW 7 101507202 missense probably benign 0.12
R1300:Pde2a UTSW 7 101510404 missense possibly damaging 0.48
R1451:Pde2a UTSW 7 101421991 nonsense probably null
R1731:Pde2a UTSW 7 101501660 missense probably damaging 1.00
R1863:Pde2a UTSW 7 101511154 missense probably damaging 1.00
R2258:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2259:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2260:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R4179:Pde2a UTSW 7 101481383 makesense probably null
R4688:Pde2a UTSW 7 101502834 missense probably benign
R4717:Pde2a UTSW 7 101494672 missense probably benign 0.00
R4723:Pde2a UTSW 7 101494618 missense possibly damaging 0.80
R4758:Pde2a UTSW 7 101511499 missense probably damaging 1.00
R4965:Pde2a UTSW 7 101502933 missense probably benign 0.01
R5034:Pde2a UTSW 7 101502024 missense probably benign 0.01
R5219:Pde2a UTSW 7 101504604 missense probably damaging 1.00
R5533:Pde2a UTSW 7 101505980 missense probably damaging 0.97
R6083:Pde2a UTSW 7 101502879 missense possibly damaging 0.93
R6365:Pde2a UTSW 7 101510363 missense probably damaging 1.00
R6372:Pde2a UTSW 7 101481392 missense probably benign 0.34
R6395:Pde2a UTSW 7 101501035 missense probably benign 0.00
R6482:Pde2a UTSW 7 101501037 missense probably benign 0.11
R6492:Pde2a UTSW 7 101500442 missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101510313 nonsense probably null
R7027:Pde2a UTSW 7 101511597 missense probably damaging 1.00
R7082:Pde2a UTSW 7 101508096 missense probably damaging 1.00
R7107:Pde2a UTSW 7 101421968 missense probably benign 0.01
R7142:Pde2a UTSW 7 101504650 missense probably damaging 1.00
R7203:Pde2a UTSW 7 101509944 missense possibly damaging 0.70
R7231:Pde2a UTSW 7 101505953 missense probably damaging 0.99
R7248:Pde2a UTSW 7 101503390 missense possibly damaging 0.88
R7570:Pde2a UTSW 7 101502834 missense probably benign 0.03
R7632:Pde2a UTSW 7 101484594 missense possibly damaging 0.64
R7658:Pde2a UTSW 7 101511581 missense possibly damaging 0.79
R8061:Pde2a UTSW 7 101503972 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGTTGCCTTCTAGGAGCTGATC -3'
(R):5'- TGAGGATACAGAGACAGCCC -3'

Sequencing Primer
(F):5'- GCCTTCTAGGAGCTGATCTACAAAG -3'
(R):5'- CTTTCTAACGCTGAGGCAGATACAG -3'
Posted On2017-08-16