Incidental Mutation 'R6114:Cpxm2'
ID485022
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Namecarboxypeptidase X 2 (M14 family)
Synonyms4632435C11Rik
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location132032687-132154739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132154306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
Predicted Effect probably benign
Transcript: ENSMUST00000033149
AA Change: V103A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: V103A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152302
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 132059811 missense probably benign 0.01
IGL02039:Cpxm2 APN 7 132047753 missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 132049078 missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 132062157 missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 132054871 missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 132128405 missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 132044043 nonsense probably null
R0655:Cpxm2 UTSW 7 132054820 missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 132154613 intron probably benign
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 132057648 missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 132128350 critical splice donor site probably null
R1563:Cpxm2 UTSW 7 132143682 missense probably benign 0.00
R1565:Cpxm2 UTSW 7 132062145 missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 132143663 splice site probably null
R1874:Cpxm2 UTSW 7 132059834 missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 132062147 missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 132059852 intron probably benign
R3806:Cpxm2 UTSW 7 132080091 missense probably benign 0.12
R3861:Cpxm2 UTSW 7 132054919 missense probably benign 0.00
R4570:Cpxm2 UTSW 7 132143706 missense probably benign 0.11
R4642:Cpxm2 UTSW 7 132070881 missense probably benign 0.11
R4684:Cpxm2 UTSW 7 132049038 missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 132054845 missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 132059747 missense probably benign 0.13
R5079:Cpxm2 UTSW 7 132154285 critical splice donor site probably null
R5341:Cpxm2 UTSW 7 132154613 intron probably benign
R5626:Cpxm2 UTSW 7 132059852 intron probably benign
R5666:Cpxm2 UTSW 7 132054896 missense probably benign 0.44
R5815:Cpxm2 UTSW 7 132044110 missense probably damaging 1.00
R6133:Cpxm2 UTSW 7 132128453 missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 132143731 missense probably benign
R6468:Cpxm2 UTSW 7 132070860 missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 132049077 missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 132143679 missense probably benign 0.32
R7100:Cpxm2 UTSW 7 132054815 missense probably benign 0.06
R7198:Cpxm2 UTSW 7 132080084 missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 132154378 missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
R7938:Cpxm2 UTSW 7 132057695 missense possibly damaging 0.56
R7950:Cpxm2 UTSW 7 132049071 missense probably damaging 1.00
RF014:Cpxm2 UTSW 7 132070863 missense possibly damaging 0.85
Z1177:Cpxm2 UTSW 7 132055001 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATTCTGTTTCTGCCTGAGGG -3'
(R):5'- CTGACTATTACAGCCAGGAGC -3'

Sequencing Primer
(F):5'- CAGGGAGAGAAAGCTGAACTTAGC -3'
(R):5'- CAGGAGCTCTGGCGGCG -3'
Posted On2017-08-16