Incidental Mutation 'R6114:Cpxm2'
ID 485022
Institutional Source Beutler Lab
Gene Symbol Cpxm2
Ensembl Gene ENSMUSG00000030862
Gene Name carboxypeptidase X, M14 family member 2
Synonyms 4632435C11Rik
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 131634416-131756468 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 131756035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000033149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033149] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033149
AA Change: V103A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033149
Gene: ENSMUSG00000030862
AA Change: V103A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 52 59 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
FA58C 143 301 2.18e-46 SMART
Zn_pept 448 736 9.21e-58 SMART
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152302
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,809,252 (GRCm39) V237L probably benign Het
Aff1 T C 5: 103,990,163 (GRCm39) S878P probably damaging Het
Ahcy A C 2: 154,904,079 (GRCm39) L386R probably damaging Het
Ank2 T C 3: 126,804,700 (GRCm39) N607D probably damaging Het
Arid5b T C 10: 67,933,574 (GRCm39) D776G possibly damaging Het
Art4 T A 6: 136,834,211 (GRCm39) T11S unknown Het
Blm T C 7: 80,163,235 (GRCm39) T39A probably damaging Het
Cabin1 T A 10: 75,583,805 (GRCm39) M221L probably benign Het
Cacna1c T C 6: 118,573,101 (GRCm39) T1675A probably benign Het
Cacnb2 A T 2: 14,980,012 (GRCm39) H285L possibly damaging Het
Cchcr1 A G 17: 35,836,227 (GRCm39) E339G probably damaging Het
Cd14 A G 18: 36,859,006 (GRCm39) W150R probably damaging Het
Cep162 A G 9: 87,085,763 (GRCm39) I1187T probably benign Het
Cntnap4 A G 8: 113,568,385 (GRCm39) H807R probably damaging Het
Copb1 T A 7: 113,846,036 (GRCm39) H178L probably benign Het
Egfr A G 11: 16,854,374 (GRCm39) T849A possibly damaging Het
Endou T A 15: 97,611,757 (GRCm39) K294* probably null Het
Hoxd9 A G 2: 74,529,709 (GRCm39) N322D probably damaging Het
Hsph1 C A 5: 149,550,852 (GRCm39) V416L possibly damaging Het
Igkv4-78 T A 6: 69,036,743 (GRCm39) T97S possibly damaging Het
Itga10 G T 3: 96,556,351 (GRCm39) C162F probably damaging Het
Lmod2 A G 6: 24,603,691 (GRCm39) E222G probably damaging Het
Lpar5 A G 6: 125,058,639 (GRCm39) N120S probably damaging Het
Lrrc37 T A 11: 103,508,617 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,632,029 (GRCm39) I1318V probably benign Het
Lst1 T C 17: 35,407,336 (GRCm39) T11A possibly damaging Het
Mfn1 C A 3: 32,617,985 (GRCm39) A106D probably damaging Het
Ms4a12 G T 19: 11,192,654 (GRCm39) N227K probably benign Het
Nr1h4 T A 10: 89,314,678 (GRCm39) N273Y possibly damaging Het
Nrdc A T 4: 108,901,782 (GRCm39) K617M probably damaging Het
Or10a3b A T 7: 108,444,593 (GRCm39) M208K possibly damaging Het
Or1l8 A T 2: 36,817,701 (GRCm39) C142S possibly damaging Het
Or6c202 T A 10: 128,996,202 (GRCm39) H217L probably benign Het
Pcdhgc3 C G 18: 37,940,925 (GRCm39) T442R probably benign Het
Pcnx2 T C 8: 126,500,686 (GRCm39) N1468S probably damaging Het
Pde2a A T 7: 101,160,319 (GRCm39) probably null Het
Pitx2 C G 3: 128,998,062 (GRCm39) probably null Het
Reck T A 4: 43,922,895 (GRCm39) I390N probably damaging Het
Rora A G 9: 69,278,605 (GRCm39) N254S probably benign Het
Samd4b A G 7: 28,222,217 (GRCm39) probably null Het
Scn8a A G 15: 100,938,477 (GRCm39) T1949A probably damaging Het
Slc22a15 A T 3: 101,768,168 (GRCm39) Y346* probably null Het
Slc24a5 A G 2: 124,925,012 (GRCm39) T218A probably benign Het
Slc38a10 G A 11: 120,020,138 (GRCm39) Q305* probably null Het
Slc45a4 G A 15: 73,477,453 (GRCm39) P28S probably damaging Het
Smyd5 A T 6: 85,417,244 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,494 (GRCm39) D403G probably damaging Het
Stx7 A G 10: 24,060,883 (GRCm39) probably null Het
Svil T C 18: 5,108,639 (GRCm39) S1522P probably damaging Het
Sycp2 G C 2: 177,990,038 (GRCm39) R1403G probably benign Het
Tasor2 G A 13: 3,640,081 (GRCm39) T352M probably damaging Het
Tcf25 A T 8: 124,111,114 (GRCm39) K192M probably damaging Het
Tecpr1 C T 5: 144,141,458 (GRCm39) G804S possibly damaging Het
Teddm1a C G 1: 153,767,614 (GRCm39) S26C probably damaging Het
Usp13 C T 3: 32,908,818 (GRCm39) P155S probably damaging Het
Usp17lb T A 7: 104,489,571 (GRCm39) D451V possibly damaging Het
Vmn1r173 A G 7: 23,402,254 (GRCm39) N163S possibly damaging Het
Vmn2r103 G T 17: 20,032,587 (GRCm39) C787F probably damaging Het
Vmn2r106 G A 17: 20,488,638 (GRCm39) P587L probably benign Het
Wdr24 C T 17: 26,043,579 (GRCm39) H134Y probably benign Het
Zbtb40 T A 4: 136,716,002 (GRCm39) I988F probably damaging Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp536 A T 7: 37,179,161 (GRCm39) I84N probably damaging Het
Other mutations in Cpxm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Cpxm2 APN 7 131,661,540 (GRCm39) missense probably benign 0.01
IGL02039:Cpxm2 APN 7 131,649,482 (GRCm39) missense probably damaging 1.00
IGL03011:Cpxm2 APN 7 131,650,807 (GRCm39) missense possibly damaging 0.46
R0033:Cpxm2 UTSW 7 131,663,886 (GRCm39) missense possibly damaging 0.55
R0100:Cpxm2 UTSW 7 131,656,600 (GRCm39) missense possibly damaging 0.90
R0100:Cpxm2 UTSW 7 131,656,600 (GRCm39) missense possibly damaging 0.90
R0453:Cpxm2 UTSW 7 131,730,134 (GRCm39) missense probably damaging 1.00
R0555:Cpxm2 UTSW 7 131,645,772 (GRCm39) nonsense probably null
R0655:Cpxm2 UTSW 7 131,656,549 (GRCm39) missense possibly damaging 0.87
R0834:Cpxm2 UTSW 7 131,756,342 (GRCm39) intron probably benign
R1145:Cpxm2 UTSW 7 131,659,377 (GRCm39) missense probably damaging 0.99
R1145:Cpxm2 UTSW 7 131,659,377 (GRCm39) missense probably damaging 0.99
R1249:Cpxm2 UTSW 7 131,730,079 (GRCm39) critical splice donor site probably null
R1563:Cpxm2 UTSW 7 131,745,411 (GRCm39) missense probably benign 0.00
R1565:Cpxm2 UTSW 7 131,663,874 (GRCm39) missense probably damaging 1.00
R1709:Cpxm2 UTSW 7 131,661,563 (GRCm39) missense probably damaging 1.00
R1863:Cpxm2 UTSW 7 131,745,392 (GRCm39) splice site probably null
R1874:Cpxm2 UTSW 7 131,661,563 (GRCm39) missense probably damaging 1.00
R1958:Cpxm2 UTSW 7 131,663,876 (GRCm39) missense probably damaging 1.00
R2273:Cpxm2 UTSW 7 131,661,581 (GRCm39) intron probably benign
R3806:Cpxm2 UTSW 7 131,681,820 (GRCm39) missense probably benign 0.12
R3861:Cpxm2 UTSW 7 131,656,648 (GRCm39) missense probably benign 0.00
R4570:Cpxm2 UTSW 7 131,745,435 (GRCm39) missense probably benign 0.11
R4642:Cpxm2 UTSW 7 131,672,610 (GRCm39) missense probably benign 0.11
R4684:Cpxm2 UTSW 7 131,650,767 (GRCm39) missense possibly damaging 0.92
R4717:Cpxm2 UTSW 7 131,656,574 (GRCm39) missense possibly damaging 0.61
R4863:Cpxm2 UTSW 7 131,661,476 (GRCm39) missense probably benign 0.13
R5079:Cpxm2 UTSW 7 131,756,014 (GRCm39) critical splice donor site probably null
R5341:Cpxm2 UTSW 7 131,756,342 (GRCm39) intron probably benign
R5626:Cpxm2 UTSW 7 131,661,581 (GRCm39) intron probably benign
R5666:Cpxm2 UTSW 7 131,656,625 (GRCm39) missense probably benign 0.44
R5815:Cpxm2 UTSW 7 131,645,839 (GRCm39) missense probably damaging 1.00
R6133:Cpxm2 UTSW 7 131,730,182 (GRCm39) missense probably damaging 1.00
R6224:Cpxm2 UTSW 7 131,745,460 (GRCm39) missense probably benign
R6468:Cpxm2 UTSW 7 131,672,589 (GRCm39) missense probably damaging 1.00
R6657:Cpxm2 UTSW 7 131,650,806 (GRCm39) missense probably damaging 1.00
R7058:Cpxm2 UTSW 7 131,745,408 (GRCm39) missense probably benign 0.32
R7100:Cpxm2 UTSW 7 131,656,544 (GRCm39) missense probably benign 0.06
R7198:Cpxm2 UTSW 7 131,681,813 (GRCm39) missense probably damaging 1.00
R7712:Cpxm2 UTSW 7 131,756,107 (GRCm39) missense possibly damaging 0.69
R7855:Cpxm2 UTSW 7 131,659,424 (GRCm39) missense possibly damaging 0.56
R7867:Cpxm2 UTSW 7 131,650,800 (GRCm39) missense probably damaging 1.00
R8513:Cpxm2 UTSW 7 131,745,431 (GRCm39) missense probably benign 0.01
R8694:Cpxm2 UTSW 7 131,681,783 (GRCm39) missense probably benign 0.03
R8874:Cpxm2 UTSW 7 131,708,010 (GRCm39) critical splice donor site probably null
R8967:Cpxm2 UTSW 7 131,661,564 (GRCm39) missense probably damaging 1.00
R9680:Cpxm2 UTSW 7 131,661,651 (GRCm39) missense probably damaging 1.00
R9759:Cpxm2 UTSW 7 131,756,242 (GRCm39) missense probably benign 0.03
RF014:Cpxm2 UTSW 7 131,672,592 (GRCm39) missense possibly damaging 0.85
Z1177:Cpxm2 UTSW 7 131,656,730 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATTCTGTTTCTGCCTGAGGG -3'
(R):5'- CTGACTATTACAGCCAGGAGC -3'

Sequencing Primer
(F):5'- CAGGGAGAGAAAGCTGAACTTAGC -3'
(R):5'- CAGGAGCTCTGGCGGCG -3'
Posted On 2017-08-16