Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Cntnap4'

485023

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

044263-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112841753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 807 (H807R)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: H807R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: H807R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: H807R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: H807R

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125976

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	112752289	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	112803226	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	112753945	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	112757596	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	112859127	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	112752966	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	112753014	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	112875968	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	112773644	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	112733471	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	112856350	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	112875549	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	112841717	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	112665176	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	112757478	missense	probably benign	0.00
R9765:Cntnap4	UTSW	8	112841864	missense	probably damaging	0.97
R9793:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	112752370	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGATCTCTTGTCCTATGCCTG -3'
(R):5'- CAGGACTAGCTGACTATGTCCCAG -3'

Sequencing Primer
(F):5'- CTATGCCTGCGAGTCTGTTAACAAG -3'
(R):5'- GACTATGTCCCAGGACCTTTCTG -3'

Posted On

2017-08-16