Incidental Mutation 'R6114:Rora'
ID 485026
Institutional Source Beutler Lab
Gene Symbol Rora
Ensembl Gene ENSMUSG00000032238
Gene Name RAR-related orphan receptor alpha
Synonyms tmgc26, Nr1f1, 9530021D13Rik
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.847) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 68653786-69388246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69371323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 254 (N254S)
Ref Sequence ENSEMBL: ENSMUSP00000109254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034766] [ENSMUST00000113624]
AlphaFold P51448
Predicted Effect probably benign
Transcript: ENSMUST00000034766
AA Change: N310S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034766
Gene: ENSMUSG00000032238
AA Change: N310S

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
ZnF_C4 70 141 4.71e-41 SMART
low complexity region 161 175 N/A INTRINSIC
HOLI 325 481 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113624
AA Change: N254S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109254
Gene: ENSMUSG00000032238
AA Change: N254S

DomainStartEndE-ValueType
ZnF_C4 14 85 4.71e-41 SMART
low complexity region 105 119 N/A INTRINSIC
HOLI 269 425 8.8e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for null mutations exhibit ataxia, cerebellar dysgenesis, impaired Purkinje and granule cell development, olfactory defects, hypoalphalipoproteinemia, and death around 4 weeks. Heterozygotes show slow Purkinje cell dedritic atrophy and loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Rora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Rora APN 9 69371290 missense probably benign 0.31
IGL02355:Rora APN 9 69374092 missense probably damaging 1.00
IGL02362:Rora APN 9 69374092 missense probably damaging 1.00
PIT4696001:Rora UTSW 9 69364559 missense possibly damaging 0.92
R0091:Rora UTSW 9 69374048 missense probably damaging 1.00
R0555:Rora UTSW 9 69361746 missense probably damaging 1.00
R0609:Rora UTSW 9 69361869 missense probably damaging 1.00
R1483:Rora UTSW 9 69364385 missense probably benign 0.00
R1712:Rora UTSW 9 69375489 missense probably benign 0.23
R1785:Rora UTSW 9 69376837 missense probably benign 0.30
R2883:Rora UTSW 9 69375435 missense probably damaging 1.00
R4173:Rora UTSW 9 68653910 missense probably benign 0.41
R5226:Rora UTSW 9 69364141 intron probably benign
R5660:Rora UTSW 9 68653921 missense probably benign 0.27
R6029:Rora UTSW 9 69364452 missense probably benign 0.04
R6054:Rora UTSW 9 69378802 missense probably benign 0.04
R6329:Rora UTSW 9 69373186 missense probably damaging 1.00
R7028:Rora UTSW 9 69196083 missense possibly damaging 0.46
R7170:Rora UTSW 9 69373190 nonsense probably null
R7233:Rora UTSW 9 69197522 nonsense probably null
R7512:Rora UTSW 9 69374085 missense probably benign 0.00
R9647:Rora UTSW 9 69348168 missense probably damaging 1.00
Z1176:Rora UTSW 9 69364372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACATTGCTTTAAGTGAGTTGC -3'
(R):5'- ACACGCTAGCATCTCAGGAAG -3'

Sequencing Primer
(F):5'- CCGGCAGAAGAGTATTATTGGCTC -3'
(R):5'- TCTCAGGAAGACAACAAAGCTCTGG -3'
Posted On 2017-08-16