Incidental Mutation 'R6114:Cep162'
ID 485027
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Name centrosomal protein 162
Synonyms 4922501C03Rik
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.123) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 87189577-87255536 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87203710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1187 (I1187T)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
AlphaFold Q6ZQ06
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: I1187T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: I1187T

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157106
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 (GRCm38) V237L probably benign Het
Aff1 T C 5: 103,842,297 (GRCm38) S878P probably damaging Het
Ahcy A C 2: 155,062,159 (GRCm38) L386R probably damaging Het
Ank2 T C 3: 127,011,051 (GRCm38) N607D probably damaging Het
Arid5b T C 10: 68,097,744 (GRCm38) D776G possibly damaging Het
Art4 T A 6: 136,857,213 (GRCm38) T11S unknown Het
Blm T C 7: 80,513,487 (GRCm38) T39A probably damaging Het
Cabin1 T A 10: 75,747,971 (GRCm38) M221L probably benign Het
Cacna1c T C 6: 118,596,140 (GRCm38) T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 (GRCm38) H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 (GRCm38) E339G probably damaging Het
Cd14 A G 18: 36,725,953 (GRCm38) W150R probably damaging Het
Cntnap4 A G 8: 112,841,753 (GRCm38) H807R probably damaging Het
Copb1 T A 7: 114,246,801 (GRCm38) H178L probably benign Het
Cpxm2 A G 7: 132,154,306 (GRCm38) V103A probably benign Het
Egfr A G 11: 16,904,374 (GRCm38) T849A possibly damaging Het
Endou T A 15: 97,713,876 (GRCm38) K294* probably null Het
Fam208b G A 13: 3,590,081 (GRCm38) T352M probably damaging Het
Gm884 T A 11: 103,617,791 (GRCm38) probably benign Het
Hoxd9 A G 2: 74,699,365 (GRCm38) N322D probably damaging Het
Hsph1 C A 5: 149,627,387 (GRCm38) V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 (GRCm38) T97S possibly damaging Het
Itga10 G T 3: 96,649,035 (GRCm38) C162F probably damaging Het
Lmod2 A G 6: 24,603,692 (GRCm38) E222G probably damaging Het
Lpar5 A G 6: 125,081,676 (GRCm38) N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 (GRCm38) I1318V probably benign Het
Lst1 T C 17: 35,188,360 (GRCm38) T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 (GRCm38) A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 (GRCm38) N227K probably benign Het
Nr1h4 T A 10: 89,478,816 (GRCm38) N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 (GRCm38) K617M probably damaging Het
Olfr355 A T 2: 36,927,689 (GRCm38) C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 (GRCm38) M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 (GRCm38) H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 (GRCm38) T442R probably benign Het
Pcnx2 T C 8: 125,773,947 (GRCm38) N1468S probably damaging Het
Pde2a A T 7: 101,511,112 (GRCm38) probably null Het
Pitx2 C G 3: 129,204,413 (GRCm38) probably null Het
Reck T A 4: 43,922,895 (GRCm38) I390N probably damaging Het
Rora A G 9: 69,371,323 (GRCm38) N254S probably benign Het
Samd4b A G 7: 28,522,792 (GRCm38) probably null Het
Scn8a A G 15: 101,040,596 (GRCm38) T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 (GRCm38) Y346* probably null Het
Slc24a5 A G 2: 125,083,092 (GRCm38) T218A probably benign Het
Slc38a10 G A 11: 120,129,312 (GRCm38) Q305* probably null Het
Slc45a4 G A 15: 73,605,604 (GRCm38) P28S probably damaging Het
Smyd5 A T 6: 85,440,262 (GRCm38) probably benign Het
Sox8 T C 17: 25,567,520 (GRCm38) D403G probably damaging Het
Stx7 A G 10: 24,184,985 (GRCm38) probably null Het
Svil T C 18: 5,108,639 (GRCm38) S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 (GRCm38) R1403G probably benign Het
Tcf25 A T 8: 123,384,375 (GRCm38) K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 (GRCm38) G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 (GRCm38) S26C probably damaging Het
Usp13 C T 3: 32,854,669 (GRCm38) P155S probably damaging Het
Usp17lb T A 7: 104,840,364 (GRCm38) D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 (GRCm38) N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 (GRCm38) C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 (GRCm38) P587L probably benign Het
Wdr24 C T 17: 25,824,605 (GRCm38) H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 (GRCm38) I988F probably damaging Het
Zfp536 A T 7: 37,479,736 (GRCm38) I84N probably damaging Het
Zfp651 T A 9: 121,765,595 (GRCm38) F540Y probably damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87,227,167 (GRCm38) missense probably benign 0.24
IGL00584:Cep162 APN 9 87,221,090 (GRCm38) splice site probably benign
IGL01387:Cep162 APN 9 87,211,811 (GRCm38) missense probably benign 0.08
IGL01862:Cep162 APN 9 87,253,933 (GRCm38) missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87,227,147 (GRCm38) splice site probably benign
IGL02558:Cep162 APN 9 87,225,726 (GRCm38) missense probably benign
IGL02558:Cep162 APN 9 87,225,733 (GRCm38) missense probably benign 0.04
IGL02602:Cep162 APN 9 87,246,153 (GRCm38) missense probably benign 0.19
IGL02636:Cep162 APN 9 87,248,379 (GRCm38) missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87,246,744 (GRCm38) missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87,225,786 (GRCm38) missense probably benign 0.00
circus UTSW 9 87,206,862 (GRCm38) missense probably damaging 1.00
moscow UTSW 9 87,193,697 (GRCm38) missense probably damaging 1.00
smiley UTSW 9 87,217,081 (GRCm38) nonsense probably null
PIT4378001:Cep162 UTSW 9 87,217,145 (GRCm38) missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87,244,345 (GRCm38) missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87,193,648 (GRCm38) missense probably damaging 1.00
R0060:Cep162 UTSW 9 87,237,825 (GRCm38) splice site probably benign
R0218:Cep162 UTSW 9 87,211,809 (GRCm38) missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87,220,484 (GRCm38) missense probably damaging 0.96
R0468:Cep162 UTSW 9 87,193,697 (GRCm38) missense probably damaging 1.00
R0764:Cep162 UTSW 9 87,201,745 (GRCm38) missense probably damaging 1.00
R1386:Cep162 UTSW 9 87,221,202 (GRCm38) missense probably benign
R1614:Cep162 UTSW 9 87,212,932 (GRCm38) missense probably damaging 1.00
R1633:Cep162 UTSW 9 87,203,683 (GRCm38) missense probably benign 0.23
R1831:Cep162 UTSW 9 87,206,932 (GRCm38) missense probably damaging 1.00
R1847:Cep162 UTSW 9 87,204,080 (GRCm38) missense probably benign 0.06
R1941:Cep162 UTSW 9 87,199,995 (GRCm38) missense probably benign 0.14
R2228:Cep162 UTSW 9 87,244,331 (GRCm38) missense probably benign 0.05
R2256:Cep162 UTSW 9 87,206,914 (GRCm38) missense probably damaging 1.00
R2257:Cep162 UTSW 9 87,206,914 (GRCm38) missense probably damaging 1.00
R2936:Cep162 UTSW 9 87,227,414 (GRCm38) missense probably benign
R3005:Cep162 UTSW 9 87,232,060 (GRCm38) missense probably benign 0.00
R3508:Cep162 UTSW 9 87,231,977 (GRCm38) critical splice donor site probably null
R3689:Cep162 UTSW 9 87,225,694 (GRCm38) nonsense probably null
R3743:Cep162 UTSW 9 87,217,177 (GRCm38) splice site probably benign
R4118:Cep162 UTSW 9 87,204,176 (GRCm38) missense probably benign 0.30
R4380:Cep162 UTSW 9 87,200,003 (GRCm38) missense probably damaging 0.99
R4450:Cep162 UTSW 9 87,225,808 (GRCm38) missense probably damaging 1.00
R4540:Cep162 UTSW 9 87,212,939 (GRCm38) missense probably damaging 1.00
R4598:Cep162 UTSW 9 87,203,795 (GRCm38) missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87,206,862 (GRCm38) missense probably damaging 1.00
R4941:Cep162 UTSW 9 87,225,969 (GRCm38) intron probably benign
R5356:Cep162 UTSW 9 87,206,895 (GRCm38) missense probably damaging 1.00
R5468:Cep162 UTSW 9 87,227,237 (GRCm38) missense probably benign 0.00
R5579:Cep162 UTSW 9 87,203,671 (GRCm38) missense probably benign 0.26
R5859:Cep162 UTSW 9 87,204,092 (GRCm38) missense probably damaging 1.00
R6143:Cep162 UTSW 9 87,212,851 (GRCm38) critical splice donor site probably null
R6422:Cep162 UTSW 9 87,232,016 (GRCm38) missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87,222,174 (GRCm38) missense probably damaging 0.99
R6576:Cep162 UTSW 9 87,217,145 (GRCm38) missense probably benign 0.01
R6782:Cep162 UTSW 9 87,211,684 (GRCm38) missense probably benign 0.07
R6867:Cep162 UTSW 9 87,217,081 (GRCm38) nonsense probably null
R7293:Cep162 UTSW 9 87,203,783 (GRCm38) missense probably benign 0.01
R7355:Cep162 UTSW 9 87,253,955 (GRCm38) nonsense probably null
R7391:Cep162 UTSW 9 87,248,494 (GRCm38) nonsense probably null
R7426:Cep162 UTSW 9 87,192,766 (GRCm38) missense probably damaging 1.00
R7593:Cep162 UTSW 9 87,204,197 (GRCm38) missense probably benign 0.40
R7710:Cep162 UTSW 9 87,232,119 (GRCm38) missense probably damaging 1.00
R7841:Cep162 UTSW 9 87,244,316 (GRCm38) missense probably benign 0.00
R7949:Cep162 UTSW 9 87,206,848 (GRCm38) missense probably benign 0.04
R8351:Cep162 UTSW 9 87,192,850 (GRCm38) nonsense probably null
R8451:Cep162 UTSW 9 87,192,850 (GRCm38) nonsense probably null
R8552:Cep162 UTSW 9 87,244,308 (GRCm38) missense probably benign 0.34
R8755:Cep162 UTSW 9 87,232,011 (GRCm38) missense probably benign 0.02
R8762:Cep162 UTSW 9 87,227,261 (GRCm38) missense probably benign 0.00
R9640:Cep162 UTSW 9 87,244,299 (GRCm38) missense probably benign 0.06
X0063:Cep162 UTSW 9 87,222,042 (GRCm38) critical splice donor site probably null
Z1177:Cep162 UTSW 9 87,199,980 (GRCm38) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAGTCCTCTATCTTCACATACTAC -3'
(R):5'- ATGATGCTGTCGAGGCAGATC -3'

Sequencing Primer
(F):5'- GCTTCACAGCTGAGAATGACTTG -3'
(R):5'- TGTCGAGGCAGATCCCCAG -3'
Posted On 2017-08-16