Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Arid5b'

485030

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

044263-MU

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68097744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 776 (D776G)

Ref Sequence

ENSEMBL: ENSMUSP00000151227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218532
AA Change: D533G

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219238
AA Change: D776G

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCATACTTGGAGGACTGTTCG -3'
(R):5'- AGCAGCTATCCCTATGGCTC -3'

Sequencing Primer
(F):5'- CCGGTAGAGGCTATGGAGATGC -3'
(R):5'- GCCCCCTTTGATCAGCAAAAAG -3'

Posted On

2017-08-16