Incidental Mutation 'R6114:Cabin1'
List |< first << previous [record 8 of 64] next >> last >|
ID485031
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Namecalcineurin binding protein 1
SynonymsCain, Ppp3in, A330070M20Rik
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75646112-75764341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75747971 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 221 (M221L)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712]
Predicted Effect probably benign
Transcript: ENSMUST00000001712
AA Change: M221L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: M221L

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218951
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75725586 missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75742429 missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75700047 missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75737418 missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75713585 missense probably benign 0.09
IGL02792:Cabin1 APN 10 75746739 missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75700100 splice site probably benign
IGL03106:Cabin1 APN 10 75733628 missense probably benign 0.01
IGL03276:Cabin1 APN 10 75732413 missense probably damaging 1.00
bison UTSW 10 75684323 missense probably damaging 1.00
range UTSW 10 75658647 missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75657049 missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75726917 missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75713610 missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75745337 missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75717677 missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75725716 missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75656806 missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75694792 missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75725745 missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75743350 splice site probably null
R1959:Cabin1 UTSW 10 75735090 missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75734976 splice site probably null
R2279:Cabin1 UTSW 10 75753461 missense probably benign
R3150:Cabin1 UTSW 10 75656911 missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75751618 critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75754841 missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75646594 missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75721363 missense probably damaging 1.00
R4944:Cabin1 UTSW 10 75739421 missense probably damaging 0.99
R5078:Cabin1 UTSW 10 75721478 missense probably damaging 1.00
R5082:Cabin1 UTSW 10 75738330 missense probably damaging 0.99
R5319:Cabin1 UTSW 10 75725715 missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75735066 missense probably benign 0.29
R5504:Cabin1 UTSW 10 75653009 missense probably benign 0.00
R5710:Cabin1 UTSW 10 75647018 missense probably benign 0.00
R5908:Cabin1 UTSW 10 75721532 missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75657839 missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75725560 missense probably benign 0.00
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6285:Cabin1 UTSW 10 75684323 missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75658739 missense probably damaging 0.98
R6361:Cabin1 UTSW 10 75726865 missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75746742 missense probably benign 0.10
R6422:Cabin1 UTSW 10 75656792 missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75725701 missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75746730 missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75721508 missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75715758 splice site probably null
R7050:Cabin1 UTSW 10 75713542 missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75743283 missense probably benign 0.04
R7101:Cabin1 UTSW 10 75751567 missense probably benign
R7138:Cabin1 UTSW 10 75745353 missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75746562 missense probably benign 0.00
R7265:Cabin1 UTSW 10 75721423 missense
R7284:Cabin1 UTSW 10 75694834 missense
R7472:Cabin1 UTSW 10 75658647 missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75646666 missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75732443 missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75658658 missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75733775 missense probably benign 0.01
R8347:Cabin1 UTSW 10 75742367 missense probably damaging 0.98
R8544:Cabin1 UTSW 10 75750056 missense probably benign 0.17
R8546:Cabin1 UTSW 10 75742267 missense probably damaging 1.00
R8692:Cabin1 UTSW 10 75751576 missense probably benign 0.28
R8839:Cabin1 UTSW 10 75656816 missense probably benign 0.00
Z1177:Cabin1 UTSW 10 75648123 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACATTTCAGAGAAACCCGGCG -3'
(R):5'- CTTTGCCCTGTTGTAAACTGTG -3'

Sequencing Primer
(F):5'- CGGCGGACACTTACGTGAAG -3'
(R):5'- GAACAAAGGGCTTCTGTGATTTCCAG -3'
Posted On2017-08-16