Incidental Mutation 'R6114:Slc38a10'
ID 485036
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Name solute carrier family 38, member 10
Synonyms 1810073N04Rik
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119994786-120042172 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 120020138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 305 (Q305*)
Ref Sequence ENSEMBL: ENSMUSP00000136719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000053692] [ENSMUST00000076697] [ENSMUST00000103018] [ENSMUST00000179094]
AlphaFold Q5I012
Predicted Effect probably null
Transcript: ENSMUST00000045402
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053692
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000057615
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 381 8.6e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076697
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000075989
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 389 4.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103018
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154444
Predicted Effect probably null
Transcript: ENSMUST00000179094
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,809,252 (GRCm39) V237L probably benign Het
Aff1 T C 5: 103,990,163 (GRCm39) S878P probably damaging Het
Ahcy A C 2: 154,904,079 (GRCm39) L386R probably damaging Het
Ank2 T C 3: 126,804,700 (GRCm39) N607D probably damaging Het
Arid5b T C 10: 67,933,574 (GRCm39) D776G possibly damaging Het
Art4 T A 6: 136,834,211 (GRCm39) T11S unknown Het
Blm T C 7: 80,163,235 (GRCm39) T39A probably damaging Het
Cabin1 T A 10: 75,583,805 (GRCm39) M221L probably benign Het
Cacna1c T C 6: 118,573,101 (GRCm39) T1675A probably benign Het
Cacnb2 A T 2: 14,980,012 (GRCm39) H285L possibly damaging Het
Cchcr1 A G 17: 35,836,227 (GRCm39) E339G probably damaging Het
Cd14 A G 18: 36,859,006 (GRCm39) W150R probably damaging Het
Cep162 A G 9: 87,085,763 (GRCm39) I1187T probably benign Het
Cntnap4 A G 8: 113,568,385 (GRCm39) H807R probably damaging Het
Copb1 T A 7: 113,846,036 (GRCm39) H178L probably benign Het
Cpxm2 A G 7: 131,756,035 (GRCm39) V103A probably benign Het
Egfr A G 11: 16,854,374 (GRCm39) T849A possibly damaging Het
Endou T A 15: 97,611,757 (GRCm39) K294* probably null Het
Hoxd9 A G 2: 74,529,709 (GRCm39) N322D probably damaging Het
Hsph1 C A 5: 149,550,852 (GRCm39) V416L possibly damaging Het
Igkv4-78 T A 6: 69,036,743 (GRCm39) T97S possibly damaging Het
Itga10 G T 3: 96,556,351 (GRCm39) C162F probably damaging Het
Lmod2 A G 6: 24,603,691 (GRCm39) E222G probably damaging Het
Lpar5 A G 6: 125,058,639 (GRCm39) N120S probably damaging Het
Lrrc37 T A 11: 103,508,617 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,632,029 (GRCm39) I1318V probably benign Het
Lst1 T C 17: 35,407,336 (GRCm39) T11A possibly damaging Het
Mfn1 C A 3: 32,617,985 (GRCm39) A106D probably damaging Het
Ms4a12 G T 19: 11,192,654 (GRCm39) N227K probably benign Het
Nr1h4 T A 10: 89,314,678 (GRCm39) N273Y possibly damaging Het
Nrdc A T 4: 108,901,782 (GRCm39) K617M probably damaging Het
Or10a3b A T 7: 108,444,593 (GRCm39) M208K possibly damaging Het
Or1l8 A T 2: 36,817,701 (GRCm39) C142S possibly damaging Het
Or6c202 T A 10: 128,996,202 (GRCm39) H217L probably benign Het
Pcdhgc3 C G 18: 37,940,925 (GRCm39) T442R probably benign Het
Pcnx2 T C 8: 126,500,686 (GRCm39) N1468S probably damaging Het
Pde2a A T 7: 101,160,319 (GRCm39) probably null Het
Pitx2 C G 3: 128,998,062 (GRCm39) probably null Het
Reck T A 4: 43,922,895 (GRCm39) I390N probably damaging Het
Rora A G 9: 69,278,605 (GRCm39) N254S probably benign Het
Samd4b A G 7: 28,222,217 (GRCm39) probably null Het
Scn8a A G 15: 100,938,477 (GRCm39) T1949A probably damaging Het
Slc22a15 A T 3: 101,768,168 (GRCm39) Y346* probably null Het
Slc24a5 A G 2: 124,925,012 (GRCm39) T218A probably benign Het
Slc45a4 G A 15: 73,477,453 (GRCm39) P28S probably damaging Het
Smyd5 A T 6: 85,417,244 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,494 (GRCm39) D403G probably damaging Het
Stx7 A G 10: 24,060,883 (GRCm39) probably null Het
Svil T C 18: 5,108,639 (GRCm39) S1522P probably damaging Het
Sycp2 G C 2: 177,990,038 (GRCm39) R1403G probably benign Het
Tasor2 G A 13: 3,640,081 (GRCm39) T352M probably damaging Het
Tcf25 A T 8: 124,111,114 (GRCm39) K192M probably damaging Het
Tecpr1 C T 5: 144,141,458 (GRCm39) G804S possibly damaging Het
Teddm1a C G 1: 153,767,614 (GRCm39) S26C probably damaging Het
Usp13 C T 3: 32,908,818 (GRCm39) P155S probably damaging Het
Usp17lb T A 7: 104,489,571 (GRCm39) D451V possibly damaging Het
Vmn1r173 A G 7: 23,402,254 (GRCm39) N163S possibly damaging Het
Vmn2r103 G T 17: 20,032,587 (GRCm39) C787F probably damaging Het
Vmn2r106 G A 17: 20,488,638 (GRCm39) P587L probably benign Het
Wdr24 C T 17: 26,043,579 (GRCm39) H134Y probably benign Het
Zbtb40 T A 4: 136,716,002 (GRCm39) I988F probably damaging Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp536 A T 7: 37,179,161 (GRCm39) I84N probably damaging Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120,029,814 (GRCm39) missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 119,997,428 (GRCm39) missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 119,997,286 (GRCm39) missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120,041,913 (GRCm39) utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120,025,600 (GRCm39) splice site probably benign
IGL02295:Slc38a10 APN 11 120,007,684 (GRCm39) splice site probably benign
IGL02300:Slc38a10 APN 11 120,001,116 (GRCm39) missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120,025,714 (GRCm39) splice site probably benign
IGL03155:Slc38a10 APN 11 119,995,945 (GRCm39) missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120,019,301 (GRCm39) missense probably damaging 1.00
Cascade UTSW 11 120,038,645 (GRCm39) missense probably damaging 1.00
cherries UTSW 11 120,041,903 (GRCm39) start codon destroyed probably null 1.00
Ore UTSW 11 120,025,679 (GRCm39) missense probably damaging 1.00
rainier UTSW 11 120,020,138 (GRCm39) nonsense probably null
slag UTSW 11 120,023,567 (GRCm39) missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120,001,138 (GRCm39) missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120,025,679 (GRCm39) missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120,025,679 (GRCm39) missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 119,997,328 (GRCm39) missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120,041,903 (GRCm39) start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120,031,469 (GRCm39) missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 119,996,301 (GRCm39) missense probably benign
R2101:Slc38a10 UTSW 11 120,023,567 (GRCm39) missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120,001,087 (GRCm39) missense probably benign 0.12
R4280:Slc38a10 UTSW 11 120,028,704 (GRCm39) missense probably damaging 1.00
R4282:Slc38a10 UTSW 11 120,020,090 (GRCm39) missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 119,995,888 (GRCm39) missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 119,996,218 (GRCm39) missense probably benign 0.11
R6118:Slc38a10 UTSW 11 120,023,669 (GRCm39) missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120,038,645 (GRCm39) missense probably damaging 1.00
R6395:Slc38a10 UTSW 11 120,015,208 (GRCm39) missense probably benign 0.01
R6428:Slc38a10 UTSW 11 119,996,298 (GRCm39) missense probably benign 0.09
R7764:Slc38a10 UTSW 11 119,995,905 (GRCm39) missense probably damaging 1.00
R7835:Slc38a10 UTSW 11 120,007,822 (GRCm39) missense possibly damaging 0.95
R8790:Slc38a10 UTSW 11 120,023,519 (GRCm39) missense possibly damaging 0.95
R9151:Slc38a10 UTSW 11 120,007,762 (GRCm39) missense probably benign 0.00
R9227:Slc38a10 UTSW 11 119,996,781 (GRCm39) missense probably benign 0.20
R9230:Slc38a10 UTSW 11 119,996,781 (GRCm39) missense probably benign 0.20
X0062:Slc38a10 UTSW 11 120,007,726 (GRCm39) missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCCCTATGCAGCAAGGAGAAAG -3'
(R):5'- GTAGAGCCTGGCATTCTGTC -3'

Sequencing Primer
(F):5'- GGAGCAAAACTAAGAGCAGAAG -3'
(R):5'- GGCATTCTGTCGGCTTCCATTAAAG -3'
Posted On 2017-08-16