Incidental Mutation 'R6114:Slc38a10'
ID485036
Institutional Source Beutler Lab
Gene Symbol Slc38a10
Ensembl Gene ENSMUSG00000061306
Gene Namesolute carrier family 38, member 10
Synonyms1810073N04Rik
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location120103960-120151346 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 120129312 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 305 (Q305*)
Ref Sequence ENSEMBL: ENSMUSP00000136719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045402] [ENSMUST00000053692] [ENSMUST00000076697] [ENSMUST00000103018] [ENSMUST00000179094]
Predicted Effect probably null
Transcript: ENSMUST00000045402
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000048675
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1.5e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 699 735 N/A INTRINSIC
low complexity region 827 837 N/A INTRINSIC
low complexity region 1011 1019 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000053692
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000057615
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 381 8.6e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000076697
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000075989
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 389 4.7e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103018
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000099307
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 8.5e-55 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154444
Predicted Effect probably null
Transcript: ENSMUST00000179094
AA Change: Q305*
SMART Domains Protein: ENSMUSP00000136719
Gene: ENSMUSG00000061306
AA Change: Q305*

DomainStartEndE-ValueType
Pfam:Aa_trans 4 398 1e-54 PFAM
low complexity region 546 563 N/A INTRINSIC
low complexity region 654 667 N/A INTRINSIC
coiled coil region 707 743 N/A INTRINSIC
low complexity region 835 845 N/A INTRINSIC
low complexity region 1019 1027 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit a fragile skeleton, reduced adiposity, lean body mass, body weight/length, long bone length and bone mineral density, increased creatinine levels, reduced amylase and serum albumin levels, increased energy efficiency and oxygen consumption, and altered liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,571,803 V237L probably benign Het
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Slc38a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Slc38a10 APN 11 120138988 missense probably damaging 1.00
IGL00236:Slc38a10 APN 11 120106602 missense probably damaging 0.96
IGL01420:Slc38a10 APN 11 120106460 missense probably damaging 0.99
IGL01704:Slc38a10 APN 11 120151087 utr 5 prime probably benign
IGL01747:Slc38a10 APN 11 120134774 splice site probably benign
IGL02295:Slc38a10 APN 11 120116858 splice site probably benign
IGL02300:Slc38a10 APN 11 120110290 missense probably benign 0.00
IGL02429:Slc38a10 APN 11 120134888 splice site probably benign
IGL03155:Slc38a10 APN 11 120105119 missense probably damaging 0.96
IGL03396:Slc38a10 APN 11 120128475 missense probably damaging 1.00
Cascade UTSW 11 120147819 missense probably damaging 1.00
cherries UTSW 11 120151077 start codon destroyed probably null 1.00
Ore UTSW 11 120134853 missense probably damaging 1.00
rainier UTSW 11 120129312 nonsense probably null
slag UTSW 11 120132741 missense probably damaging 1.00
R0048:Slc38a10 UTSW 11 120110312 missense probably benign 0.11
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0068:Slc38a10 UTSW 11 120134853 missense probably damaging 1.00
R0069:Slc38a10 UTSW 11 120106502 missense probably damaging 1.00
R0101:Slc38a10 UTSW 11 120151077 start codon destroyed probably null 1.00
R0743:Slc38a10 UTSW 11 120140643 missense probably damaging 1.00
R1159:Slc38a10 UTSW 11 120105475 missense probably benign
R2101:Slc38a10 UTSW 11 120132741 missense probably damaging 1.00
R2367:Slc38a10 UTSW 11 120110261 missense probably benign 0.12
R4280:Slc38a10 UTSW 11 120137878 missense probably damaging 1.00
R4282:Slc38a10 UTSW 11 120129264 missense probably damaging 1.00
R5206:Slc38a10 UTSW 11 120105062 missense probably damaging 0.99
R5658:Slc38a10 UTSW 11 120105392 missense probably benign 0.11
R6118:Slc38a10 UTSW 11 120132843 missense probably damaging 1.00
R6306:Slc38a10 UTSW 11 120147819 missense probably damaging 1.00
R6395:Slc38a10 UTSW 11 120124382 missense probably benign 0.01
R6428:Slc38a10 UTSW 11 120105472 missense probably benign 0.09
R7764:Slc38a10 UTSW 11 120105079 missense probably damaging 1.00
R7835:Slc38a10 UTSW 11 120116996 missense possibly damaging 0.95
R7918:Slc38a10 UTSW 11 120116996 missense possibly damaging 0.95
X0062:Slc38a10 UTSW 11 120116900 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CCCCTATGCAGCAAGGAGAAAG -3'
(R):5'- GTAGAGCCTGGCATTCTGTC -3'

Sequencing Primer
(F):5'- GGAGCAAAACTAAGAGCAGAAG -3'
(R):5'- GGCATTCTGTCGGCTTCCATTAAAG -3'
Posted On2017-08-16