Incidental Mutation 'R6114:Tasor2'
ID 485037
Institutional Source Beutler Lab
Gene Symbol Tasor2
Ensembl Gene ENSMUSG00000033799
Gene Name transcription activation suppressor family member 2
Synonyms BC016423, Fam208b
MMRRC Submission 044263-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R6114 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 3616035-3661108 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3640081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 352 (T352M)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
AlphaFold Q5DTT3
Predicted Effect probably damaging
Transcript: ENSMUST00000096069
AA Change: T352M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: T352M

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222041
Predicted Effect probably benign
Transcript: ENSMUST00000222909
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 C A 14: 68,809,252 (GRCm39) V237L probably benign Het
Aff1 T C 5: 103,990,163 (GRCm39) S878P probably damaging Het
Ahcy A C 2: 154,904,079 (GRCm39) L386R probably damaging Het
Ank2 T C 3: 126,804,700 (GRCm39) N607D probably damaging Het
Arid5b T C 10: 67,933,574 (GRCm39) D776G possibly damaging Het
Art4 T A 6: 136,834,211 (GRCm39) T11S unknown Het
Blm T C 7: 80,163,235 (GRCm39) T39A probably damaging Het
Cabin1 T A 10: 75,583,805 (GRCm39) M221L probably benign Het
Cacna1c T C 6: 118,573,101 (GRCm39) T1675A probably benign Het
Cacnb2 A T 2: 14,980,012 (GRCm39) H285L possibly damaging Het
Cchcr1 A G 17: 35,836,227 (GRCm39) E339G probably damaging Het
Cd14 A G 18: 36,859,006 (GRCm39) W150R probably damaging Het
Cep162 A G 9: 87,085,763 (GRCm39) I1187T probably benign Het
Cntnap4 A G 8: 113,568,385 (GRCm39) H807R probably damaging Het
Copb1 T A 7: 113,846,036 (GRCm39) H178L probably benign Het
Cpxm2 A G 7: 131,756,035 (GRCm39) V103A probably benign Het
Egfr A G 11: 16,854,374 (GRCm39) T849A possibly damaging Het
Endou T A 15: 97,611,757 (GRCm39) K294* probably null Het
Hoxd9 A G 2: 74,529,709 (GRCm39) N322D probably damaging Het
Hsph1 C A 5: 149,550,852 (GRCm39) V416L possibly damaging Het
Igkv4-78 T A 6: 69,036,743 (GRCm39) T97S possibly damaging Het
Itga10 G T 3: 96,556,351 (GRCm39) C162F probably damaging Het
Lmod2 A G 6: 24,603,691 (GRCm39) E222G probably damaging Het
Lpar5 A G 6: 125,058,639 (GRCm39) N120S probably damaging Het
Lrrc37 T A 11: 103,508,617 (GRCm39) probably benign Het
Lrrk2 A G 15: 91,632,029 (GRCm39) I1318V probably benign Het
Lst1 T C 17: 35,407,336 (GRCm39) T11A possibly damaging Het
Mfn1 C A 3: 32,617,985 (GRCm39) A106D probably damaging Het
Ms4a12 G T 19: 11,192,654 (GRCm39) N227K probably benign Het
Nr1h4 T A 10: 89,314,678 (GRCm39) N273Y possibly damaging Het
Nrdc A T 4: 108,901,782 (GRCm39) K617M probably damaging Het
Or10a3b A T 7: 108,444,593 (GRCm39) M208K possibly damaging Het
Or1l8 A T 2: 36,817,701 (GRCm39) C142S possibly damaging Het
Or6c202 T A 10: 128,996,202 (GRCm39) H217L probably benign Het
Pcdhgc3 C G 18: 37,940,925 (GRCm39) T442R probably benign Het
Pcnx2 T C 8: 126,500,686 (GRCm39) N1468S probably damaging Het
Pde2a A T 7: 101,160,319 (GRCm39) probably null Het
Pitx2 C G 3: 128,998,062 (GRCm39) probably null Het
Reck T A 4: 43,922,895 (GRCm39) I390N probably damaging Het
Rora A G 9: 69,278,605 (GRCm39) N254S probably benign Het
Samd4b A G 7: 28,222,217 (GRCm39) probably null Het
Scn8a A G 15: 100,938,477 (GRCm39) T1949A probably damaging Het
Slc22a15 A T 3: 101,768,168 (GRCm39) Y346* probably null Het
Slc24a5 A G 2: 124,925,012 (GRCm39) T218A probably benign Het
Slc38a10 G A 11: 120,020,138 (GRCm39) Q305* probably null Het
Slc45a4 G A 15: 73,477,453 (GRCm39) P28S probably damaging Het
Smyd5 A T 6: 85,417,244 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,494 (GRCm39) D403G probably damaging Het
Stx7 A G 10: 24,060,883 (GRCm39) probably null Het
Svil T C 18: 5,108,639 (GRCm39) S1522P probably damaging Het
Sycp2 G C 2: 177,990,038 (GRCm39) R1403G probably benign Het
Tcf25 A T 8: 124,111,114 (GRCm39) K192M probably damaging Het
Tecpr1 C T 5: 144,141,458 (GRCm39) G804S possibly damaging Het
Teddm1a C G 1: 153,767,614 (GRCm39) S26C probably damaging Het
Usp13 C T 3: 32,908,818 (GRCm39) P155S probably damaging Het
Usp17lb T A 7: 104,489,571 (GRCm39) D451V possibly damaging Het
Vmn1r173 A G 7: 23,402,254 (GRCm39) N163S possibly damaging Het
Vmn2r103 G T 17: 20,032,587 (GRCm39) C787F probably damaging Het
Vmn2r106 G A 17: 20,488,638 (GRCm39) P587L probably benign Het
Wdr24 C T 17: 26,043,579 (GRCm39) H134Y probably benign Het
Zbtb40 T A 4: 136,716,002 (GRCm39) I988F probably damaging Het
Zbtb47 T A 9: 121,594,661 (GRCm39) F540Y probably damaging Het
Zfp536 A T 7: 37,179,161 (GRCm39) I84N probably damaging Het
Other mutations in Tasor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Tasor2 APN 13 3,624,832 (GRCm39) missense probably benign
IGL00670:Tasor2 APN 13 3,635,241 (GRCm39) missense probably benign 0.14
IGL00957:Tasor2 APN 13 3,627,101 (GRCm39) missense possibly damaging 0.86
IGL01311:Tasor2 APN 13 3,625,885 (GRCm39) missense possibly damaging 0.85
IGL01318:Tasor2 APN 13 3,625,067 (GRCm39) missense possibly damaging 0.66
IGL01767:Tasor2 APN 13 3,626,633 (GRCm39) missense probably benign 0.00
IGL02073:Tasor2 APN 13 3,624,721 (GRCm39) missense probably benign 0.01
IGL02152:Tasor2 APN 13 3,635,371 (GRCm39) missense probably benign
IGL02431:Tasor2 APN 13 3,624,736 (GRCm39) missense possibly damaging 0.85
IGL02478:Tasor2 APN 13 3,624,661 (GRCm39) missense probably benign 0.12
IGL02732:Tasor2 APN 13 3,623,626 (GRCm39) missense probably benign 0.09
IGL02745:Tasor2 APN 13 3,635,140 (GRCm39) missense probably benign 0.23
IGL02800:Tasor2 APN 13 3,635,154 (GRCm39) missense probably benign
IGL02989:Tasor2 APN 13 3,634,820 (GRCm39) missense probably benign 0.01
IGL03124:Tasor2 APN 13 3,624,704 (GRCm39) missense probably benign 0.41
IGL03154:Tasor2 APN 13 3,625,255 (GRCm39) missense possibly damaging 0.56
IGL03216:Tasor2 APN 13 3,624,553 (GRCm39) missense probably damaging 0.98
BB001:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
BB011:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
H8562:Tasor2 UTSW 13 3,627,000 (GRCm39) missense probably damaging 0.98
PIT4585001:Tasor2 UTSW 13 3,624,979 (GRCm39) missense possibly damaging 0.55
R0016:Tasor2 UTSW 13 3,635,170 (GRCm39) splice site probably null
R0016:Tasor2 UTSW 13 3,635,170 (GRCm39) splice site probably null
R0157:Tasor2 UTSW 13 3,625,550 (GRCm39) missense probably benign 0.06
R0375:Tasor2 UTSW 13 3,646,842 (GRCm39) missense possibly damaging 0.85
R0403:Tasor2 UTSW 13 3,632,052 (GRCm39) nonsense probably null
R0472:Tasor2 UTSW 13 3,638,364 (GRCm39) missense possibly damaging 0.93
R0517:Tasor2 UTSW 13 3,616,964 (GRCm39) missense possibly damaging 0.94
R0586:Tasor2 UTSW 13 3,640,321 (GRCm39) missense probably damaging 0.99
R0600:Tasor2 UTSW 13 3,626,054 (GRCm39) missense probably benign
R0659:Tasor2 UTSW 13 3,624,448 (GRCm39) missense probably damaging 0.99
R1257:Tasor2 UTSW 13 3,625,049 (GRCm39) missense probably benign 0.25
R1375:Tasor2 UTSW 13 3,626,029 (GRCm39) missense probably benign 0.06
R1443:Tasor2 UTSW 13 3,625,543 (GRCm39) missense probably benign 0.00
R1497:Tasor2 UTSW 13 3,620,409 (GRCm39) missense probably damaging 0.96
R1544:Tasor2 UTSW 13 3,640,413 (GRCm39) missense possibly damaging 0.68
R1554:Tasor2 UTSW 13 3,626,374 (GRCm39) missense possibly damaging 0.85
R1629:Tasor2 UTSW 13 3,624,121 (GRCm39) missense possibly damaging 0.84
R1633:Tasor2 UTSW 13 3,631,771 (GRCm39) missense possibly damaging 0.53
R1661:Tasor2 UTSW 13 3,623,860 (GRCm39) missense possibly damaging 0.63
R1673:Tasor2 UTSW 13 3,634,498 (GRCm39) critical splice donor site probably null
R1675:Tasor2 UTSW 13 3,619,507 (GRCm39) missense possibly damaging 0.65
R1781:Tasor2 UTSW 13 3,634,759 (GRCm39) missense possibly damaging 0.95
R1792:Tasor2 UTSW 13 3,640,559 (GRCm39) missense possibly damaging 0.91
R1826:Tasor2 UTSW 13 3,631,759 (GRCm39) missense probably damaging 0.98
R1920:Tasor2 UTSW 13 3,626,612 (GRCm39) missense possibly damaging 0.63
R1983:Tasor2 UTSW 13 3,624,853 (GRCm39) missense possibly damaging 0.92
R2016:Tasor2 UTSW 13 3,626,770 (GRCm39) missense probably benign 0.41
R2017:Tasor2 UTSW 13 3,626,770 (GRCm39) missense probably benign 0.41
R2220:Tasor2 UTSW 13 3,631,872 (GRCm39) missense probably benign 0.00
R2513:Tasor2 UTSW 13 3,632,150 (GRCm39) missense possibly damaging 0.53
R2898:Tasor2 UTSW 13 3,635,122 (GRCm39) missense possibly damaging 0.82
R2904:Tasor2 UTSW 13 3,632,185 (GRCm39) missense possibly damaging 0.53
R3149:Tasor2 UTSW 13 3,624,359 (GRCm39) missense probably damaging 0.98
R3623:Tasor2 UTSW 13 3,645,556 (GRCm39) missense probably benign
R3624:Tasor2 UTSW 13 3,645,556 (GRCm39) missense probably benign
R3725:Tasor2 UTSW 13 3,640,538 (GRCm39) missense probably benign 0.33
R3835:Tasor2 UTSW 13 3,625,292 (GRCm39) missense probably benign 0.01
R3890:Tasor2 UTSW 13 3,646,785 (GRCm39) missense probably damaging 0.96
R4023:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4024:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4025:Tasor2 UTSW 13 3,634,554 (GRCm39) missense probably damaging 0.99
R4050:Tasor2 UTSW 13 3,623,507 (GRCm39) missense probably benign 0.09
R4308:Tasor2 UTSW 13 3,619,498 (GRCm39) missense probably damaging 0.97
R4484:Tasor2 UTSW 13 3,631,831 (GRCm39) missense probably benign 0.12
R4674:Tasor2 UTSW 13 3,623,686 (GRCm39) missense possibly damaging 0.69
R4718:Tasor2 UTSW 13 3,624,495 (GRCm39) missense probably benign 0.00
R4745:Tasor2 UTSW 13 3,640,069 (GRCm39) missense probably benign 0.26
R4776:Tasor2 UTSW 13 3,620,391 (GRCm39) missense probably damaging 1.00
R4839:Tasor2 UTSW 13 3,634,807 (GRCm39) missense probably damaging 0.96
R4855:Tasor2 UTSW 13 3,616,680 (GRCm39) splice site probably null
R5049:Tasor2 UTSW 13 3,624,000 (GRCm39) missense probably benign 0.00
R5076:Tasor2 UTSW 13 3,626,357 (GRCm39) missense probably benign 0.41
R5287:Tasor2 UTSW 13 3,625,744 (GRCm39) missense probably benign 0.41
R5298:Tasor2 UTSW 13 3,645,613 (GRCm39) splice site probably null
R5379:Tasor2 UTSW 13 3,638,496 (GRCm39) missense probably benign 0.41
R5512:Tasor2 UTSW 13 3,645,517 (GRCm39) missense probably damaging 0.99
R5624:Tasor2 UTSW 13 3,634,996 (GRCm39) missense possibly damaging 0.66
R5750:Tasor2 UTSW 13 3,623,642 (GRCm39) nonsense probably null
R6118:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6119:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6269:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6270:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6271:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6272:Tasor2 UTSW 13 3,631,891 (GRCm39) missense possibly damaging 0.76
R6525:Tasor2 UTSW 13 3,626,540 (GRCm39) nonsense probably null
R6550:Tasor2 UTSW 13 3,640,519 (GRCm39) missense possibly damaging 0.85
R6714:Tasor2 UTSW 13 3,644,189 (GRCm39) missense probably benign 0.00
R6797:Tasor2 UTSW 13 3,626,769 (GRCm39) missense probably benign 0.26
R6967:Tasor2 UTSW 13 3,624,819 (GRCm39) missense probably benign 0.22
R7016:Tasor2 UTSW 13 3,626,857 (GRCm39) missense possibly damaging 0.92
R7219:Tasor2 UTSW 13 3,640,521 (GRCm39) missense probably damaging 0.99
R7454:Tasor2 UTSW 13 3,635,332 (GRCm39) missense probably benign 0.21
R7570:Tasor2 UTSW 13 3,623,621 (GRCm39) missense probably damaging 0.99
R7571:Tasor2 UTSW 13 3,625,292 (GRCm39) missense probably benign 0.01
R7580:Tasor2 UTSW 13 3,624,752 (GRCm39) missense probably damaging 0.99
R7587:Tasor2 UTSW 13 3,618,849 (GRCm39) missense possibly damaging 0.83
R7657:Tasor2 UTSW 13 3,623,777 (GRCm39) missense probably damaging 0.98
R7810:Tasor2 UTSW 13 3,625,714 (GRCm39) missense possibly damaging 0.61
R7909:Tasor2 UTSW 13 3,623,765 (GRCm39) missense possibly damaging 0.93
R7924:Tasor2 UTSW 13 3,644,331 (GRCm39) missense possibly damaging 0.92
R7945:Tasor2 UTSW 13 3,626,085 (GRCm39) missense probably benign
R8005:Tasor2 UTSW 13 3,625,681 (GRCm39) missense probably benign
R8067:Tasor2 UTSW 13 3,619,602 (GRCm39) missense probably benign
R8112:Tasor2 UTSW 13 3,619,516 (GRCm39) missense probably damaging 1.00
R8162:Tasor2 UTSW 13 3,649,691 (GRCm39) missense probably damaging 0.96
R8170:Tasor2 UTSW 13 3,624,881 (GRCm39) nonsense probably null
R8240:Tasor2 UTSW 13 3,624,388 (GRCm39) missense probably benign
R8263:Tasor2 UTSW 13 3,640,016 (GRCm39) missense probably benign 0.03
R8263:Tasor2 UTSW 13 3,625,286 (GRCm39) missense possibly damaging 0.70
R8477:Tasor2 UTSW 13 3,625,079 (GRCm39) missense probably benign 0.18
R9022:Tasor2 UTSW 13 3,626,659 (GRCm39) missense probably benign
R9140:Tasor2 UTSW 13 3,638,441 (GRCm39) missense probably benign 0.04
R9167:Tasor2 UTSW 13 3,624,724 (GRCm39) missense probably benign
R9527:Tasor2 UTSW 13 3,635,191 (GRCm39) missense possibly damaging 0.61
R9535:Tasor2 UTSW 13 3,623,559 (GRCm39) missense possibly damaging 0.69
R9711:Tasor2 UTSW 13 3,649,667 (GRCm39) missense probably benign
X0024:Tasor2 UTSW 13 3,649,837 (GRCm39) missense probably null 0.99
X0025:Tasor2 UTSW 13 3,626,827 (GRCm39) missense probably benign 0.15
X0066:Tasor2 UTSW 13 3,638,441 (GRCm39) missense probably benign 0.04
Z1176:Tasor2 UTSW 13 3,638,429 (GRCm39) missense probably damaging 0.98
Z1176:Tasor2 UTSW 13 3,626,636 (GRCm39) missense probably benign 0.01
Z1177:Tasor2 UTSW 13 3,624,234 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGGATAGTCAATAGGGTTTGTG -3'
(R):5'- TTCCCTTGCATTGCAGACGG -3'

Sequencing Primer
(F):5'- GATAGTCAATAGGGTTTGTGGTAAAG -3'
(R):5'- GCATTGCAGACGGGGTTTG -3'
Posted On 2017-08-16