Incidental Mutation 'R6114:Adamdec1'
ID485038
Institutional Source Beutler Lab
Gene Symbol Adamdec1
Ensembl Gene ENSMUSG00000022057
Gene NameADAM-like, decysin 1
Synonyms2210414L24Rik, Dcsn
MMRRC Submission 044263-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6114 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location68563380-68582095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68571803 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 237 (V237L)
Ref Sequence ENSEMBL: ENSMUSP00000022641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022641]
Predicted Effect probably benign
Transcript: ENSMUST00000022641
AA Change: V237L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000022641
Gene: ENSMUSG00000022057
AA Change: V237L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 37 175 3.9e-29 PFAM
Pfam:Reprolysin_5 215 389 9.8e-17 PFAM
Pfam:Reprolysin_4 216 407 7.3e-12 PFAM
Pfam:Reprolysin 217 411 1.5e-57 PFAM
Pfam:Reprolysin_3 242 360 1e-11 PFAM
DISIN 427 465 1.12e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 94% (60/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This encoded protein is thought to be a secreted protein belonging to the disintegrin metalloproteinase family. Its expression is upregulated during dendritic cells maturation. This protein may play an important role in dendritic cell function and their interactions with germinal center T cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,297 S878P probably damaging Het
Ahcy A C 2: 155,062,159 L386R probably damaging Het
Ank2 T C 3: 127,011,051 N607D probably damaging Het
Arid5b T C 10: 68,097,744 D776G possibly damaging Het
Art4 T A 6: 136,857,213 T11S unknown Het
Blm T C 7: 80,513,487 T39A probably damaging Het
Cabin1 T A 10: 75,747,971 M221L probably benign Het
Cacna1c T C 6: 118,596,140 T1675A probably benign Het
Cacnb2 A T 2: 14,975,201 H285L possibly damaging Het
Cchcr1 A G 17: 35,525,330 E339G probably damaging Het
Cd14 A G 18: 36,725,953 W150R probably damaging Het
Cep162 A G 9: 87,203,710 I1187T probably benign Het
Cntnap4 A G 8: 112,841,753 H807R probably damaging Het
Copb1 T A 7: 114,246,801 H178L probably benign Het
Cpxm2 A G 7: 132,154,306 V103A probably benign Het
Egfr A G 11: 16,904,374 T849A possibly damaging Het
Endou T A 15: 97,713,876 K294* probably null Het
Fam208b G A 13: 3,590,081 T352M probably damaging Het
Gm884 T A 11: 103,617,791 probably benign Het
Hoxd9 A G 2: 74,699,365 N322D probably damaging Het
Hsph1 C A 5: 149,627,387 V416L possibly damaging Het
Igkv4-78 T A 6: 69,059,759 T97S possibly damaging Het
Itga10 G T 3: 96,649,035 C162F probably damaging Het
Lmod2 A G 6: 24,603,692 E222G probably damaging Het
Lpar5 A G 6: 125,081,676 N120S probably damaging Het
Lrrk2 A G 15: 91,747,826 I1318V probably benign Het
Lst1 T C 17: 35,188,360 T11A possibly damaging Het
Mfn1 C A 3: 32,563,836 A106D probably damaging Het
Ms4a12 G T 19: 11,215,290 N227K probably benign Het
Nr1h4 T A 10: 89,478,816 N273Y possibly damaging Het
Nrd1 A T 4: 109,044,585 K617M probably damaging Het
Olfr355 A T 2: 36,927,689 C142S possibly damaging Het
Olfr516 A T 7: 108,845,386 M208K possibly damaging Het
Olfr771 T A 10: 129,160,333 H217L probably benign Het
Pcdhgc3 C G 18: 37,807,872 T442R probably benign Het
Pcnx2 T C 8: 125,773,947 N1468S probably damaging Het
Pde2a A T 7: 101,511,112 probably null Het
Pitx2 C G 3: 129,204,413 probably null Het
Reck T A 4: 43,922,895 I390N probably damaging Het
Rora A G 9: 69,371,323 N254S probably benign Het
Samd4b A G 7: 28,522,792 probably null Het
Scn8a A G 15: 101,040,596 T1949A probably damaging Het
Slc22a15 A T 3: 101,860,852 Y346* probably null Het
Slc24a5 A G 2: 125,083,092 T218A probably benign Het
Slc38a10 G A 11: 120,129,312 Q305* probably null Het
Slc45a4 G A 15: 73,605,604 P28S probably damaging Het
Smyd5 A T 6: 85,440,262 probably benign Het
Sox8 T C 17: 25,567,520 D403G probably damaging Het
Stx7 A G 10: 24,184,985 probably null Het
Svil T C 18: 5,108,639 S1522P probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tcf25 A T 8: 123,384,375 K192M probably damaging Het
Tecpr1 C T 5: 144,204,640 G804S possibly damaging Het
Teddm1a C G 1: 153,891,868 S26C probably damaging Het
Usp13 C T 3: 32,854,669 P155S probably damaging Het
Usp17lb T A 7: 104,840,364 D451V possibly damaging Het
Vmn1r173 A G 7: 23,702,829 N163S possibly damaging Het
Vmn2r103 G T 17: 19,812,325 C787F probably damaging Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Zbtb40 T A 4: 136,988,691 I988F probably damaging Het
Zfp536 A T 7: 37,479,736 I84N probably damaging Het
Zfp651 T A 9: 121,765,595 F540Y probably damaging Het
Other mutations in Adamdec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Adamdec1 APN 14 68573107 missense probably damaging 1.00
IGL02026:Adamdec1 APN 14 68571802 missense possibly damaging 0.81
IGL02068:Adamdec1 APN 14 68577109 missense probably benign 0.21
IGL02416:Adamdec1 APN 14 68572833 missense probably null 0.99
IGL02739:Adamdec1 APN 14 68570156 nonsense probably null
IGL03078:Adamdec1 APN 14 68568850 missense possibly damaging 0.53
IGL03115:Adamdec1 APN 14 68571353 missense probably damaging 1.00
R0201:Adamdec1 UTSW 14 68581957 critical splice donor site probably null
R0243:Adamdec1 UTSW 14 68581958 critical splice donor site probably null
R0244:Adamdec1 UTSW 14 68568723 nonsense probably null
R0416:Adamdec1 UTSW 14 68568712 missense possibly damaging 0.79
R1373:Adamdec1 UTSW 14 68570951 missense probably damaging 1.00
R1856:Adamdec1 UTSW 14 68570948 missense probably damaging 1.00
R2570:Adamdec1 UTSW 14 68579208 missense probably damaging 0.98
R3684:Adamdec1 UTSW 14 68581998 missense probably benign 0.04
R3755:Adamdec1 UTSW 14 68577138 missense probably damaging 1.00
R4450:Adamdec1 UTSW 14 68573119 missense probably benign 0.00
R4661:Adamdec1 UTSW 14 68570113 missense probably damaging 1.00
R4672:Adamdec1 UTSW 14 68577904 nonsense probably null
R4673:Adamdec1 UTSW 14 68577904 nonsense probably null
R4902:Adamdec1 UTSW 14 68571766 missense probably damaging 0.99
R5017:Adamdec1 UTSW 14 68573245 missense probably benign 0.01
R5018:Adamdec1 UTSW 14 68571779 missense probably damaging 1.00
R5141:Adamdec1 UTSW 14 68573128 missense probably benign 0.00
R5329:Adamdec1 UTSW 14 68570163 missense probably damaging 1.00
R5395:Adamdec1 UTSW 14 68570903 missense probably benign 0.04
R5864:Adamdec1 UTSW 14 68570102 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6032:Adamdec1 UTSW 14 68579184 missense probably damaging 1.00
R6633:Adamdec1 UTSW 14 68573152 missense probably benign 0.03
R7243:Adamdec1 UTSW 14 68571754 missense probably benign 0.06
R7580:Adamdec1 UTSW 14 68565531 missense probably benign 0.00
X0025:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0050:Adamdec1 UTSW 14 68570158 missense probably damaging 1.00
X0062:Adamdec1 UTSW 14 68573252 missense probably benign 0.12
Z1177:Adamdec1 UTSW 14 68580643 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACAAGTGATAGATAAAGGGATGT -3'
(R):5'- TACCTGAAAGCAATCAACTGTAAAA -3'

Sequencing Primer
(F):5'- TGATAGAAAAAGGCTTTGTTACTGTC -3'
(R):5'- CAATCCTTGGAAAGTTTCACTGGG -3'
Posted On2017-08-16