Incidental Mutation 'R0521:Kdm5b'
ID 48504
Institutional Source Beutler Lab
Gene Symbol Kdm5b
Ensembl Gene ENSMUSG00000042207
Gene Name lysine (K)-specific demethylase 5B
Synonyms Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e
MMRRC Submission 038714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock # R0521 (G1)
Quality Score 148
Status Not validated
Chromosome 1
Chromosomal Location 134560171-134635285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 134618033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 977 (S977R)
Ref Sequence ENSEMBL: ENSMUSP00000107817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]
AlphaFold Q80Y84
PDB Structure Solution structure of the ARID domain of Jarid1b protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047714
AA Change: S977R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: S977R

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 744 2.2e-17 PFAM
Pfam:PLU-1 757 1088 5.6e-92 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
PHD 1486 1536 1.18e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112198
AA Change: S977R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207
AA Change: S977R

DomainStartEndE-ValueType
low complexity region 7 30 N/A INTRINSIC
JmjN 31 72 2.87e-20 SMART
ARID 94 183 7.39e-32 SMART
BRIGHT 98 188 1.51e-35 SMART
low complexity region 228 239 N/A INTRINSIC
PHD 311 357 6.15e-14 SMART
JmjC 453 619 2.33e-67 SMART
Pfam:zf-C5HC2 692 745 6.7e-21 PFAM
Pfam:PLU-1 756 1088 6e-94 PFAM
low complexity region 1097 1109 N/A INTRINSIC
PHD 1178 1222 6.2e-10 SMART
low complexity region 1225 1236 N/A INTRINSIC
low complexity region 1406 1417 N/A INTRINSIC
low complexity region 1470 1484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191572
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Aadacl3 A T 4: 144,455,894 S335T probably damaging Het
Abcb1b G A 5: 8,864,238 A1203T probably damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Angel1 G A 12: 86,722,907 S193F probably benign Het
Ankrd16 T C 2: 11,789,881 V359A probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Armc4 G A 18: 7,222,676 P531L possibly damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Bpifa5 C A 2: 154,166,949 D223E probably benign Het
C87499 A T 4: 88,629,322 N37K probably damaging Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Ccm2 G A 11: 6,590,886 S184N probably damaging Het
Ces5a T A 8: 93,525,658 D202V probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Cog7 C A 7: 121,941,169 probably null Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Cps1 A C 1: 67,215,564 D1304A probably benign Het
Crhbp C A 13: 95,443,895 probably null Het
Ctdspl2 T A 2: 122,006,887 C377* probably null Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Ddost A G 4: 138,310,735 T262A probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx54 A G 5: 120,626,862 I769V probably benign Het
Dock1 T A 7: 135,143,778 I1463N probably benign Het
Dsg3 T A 18: 20,527,815 Y404N possibly damaging Het
Epb42 T A 2: 121,029,150 K186* probably null Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Farp2 A G 1: 93,576,821 probably null Het
Fev C A 1: 74,882,533 R86L possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Foxn3 A G 12: 99,209,506 V261A probably benign Het
Fsd1 A G 17: 55,991,245 D190G probably benign Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Gsdma2 A T 11: 98,654,901 K260* probably null Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hic1 G A 11: 75,166,887 P392L possibly damaging Het
Hk3 C T 13: 55,014,426 probably null Het
Ifna6 G T 4: 88,827,650 V79F probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Lrrc29 A T 8: 105,312,793 L617Q probably damaging Het
Map1a T G 2: 121,305,753 L2350R probably damaging Het
Mdfic A G 6: 15,799,756 D212G probably benign Het
Ms4a1 C A 19: 11,258,679 probably null Het
Myo9a T A 9: 59,894,352 F1944L probably damaging Het
Nbea A T 3: 56,008,268 W928R probably damaging Het
Nfatc2ip T G 7: 126,396,579 D46A possibly damaging Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nsd2 T A 5: 33,843,338 N66K probably damaging Het
Nsmce4a T C 7: 130,537,002 H304R probably damaging Het
Olfr1099 C T 2: 86,958,846 G204D probably damaging Het
Olfr1239 T C 2: 89,418,200 Y71C probably damaging Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr859 G A 9: 19,808,860 V181I probably benign Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
R3hdm1 G A 1: 128,193,703 V315I probably benign Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Setdb1 A G 3: 95,338,829 V595A probably benign Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Thnsl2 A T 6: 71,134,259 D208E probably damaging Het
Tie1 A C 4: 118,476,146 I841R probably damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tnfaip8l1 A T 17: 56,171,727 T6S probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Vmn2r9 C A 5: 108,848,288 G165* probably null Het
Xkr6 A T 14: 63,819,422 I261F probably benign Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Yipf1 A G 4: 107,336,190 Y91C probably benign Het
Zfp442 T C 2: 150,411,249 D31G possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zfp804a C T 2: 82,259,417 Q1197* probably null Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Kdm5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kdm5b APN 1 134620955 missense probably damaging 1.00
IGL01458:Kdm5b APN 1 134621986 missense possibly damaging 0.53
IGL01567:Kdm5b APN 1 134602540 missense probably damaging 1.00
IGL01625:Kdm5b APN 1 134617968 missense possibly damaging 0.74
IGL01970:Kdm5b APN 1 134600727 missense probably damaging 1.00
IGL02183:Kdm5b APN 1 134624931 missense probably benign 0.09
IGL02592:Kdm5b APN 1 134624853 missense probably damaging 0.99
IGL02695:Kdm5b APN 1 134604485 missense possibly damaging 0.94
IGL02697:Kdm5b APN 1 134588773 splice site probably benign
IGL03036:Kdm5b APN 1 134608937 missense probably damaging 1.00
IGL03056:Kdm5b APN 1 134587979 missense probably damaging 0.99
IGL03206:Kdm5b APN 1 134627317 missense probably benign
IGL03342:Kdm5b APN 1 134602576 missense probably benign 0.00
IGL03388:Kdm5b APN 1 134627322 missense probably benign
amaryllis UTSW 1 134609061 critical splice donor site probably null
PIT4486001:Kdm5b UTSW 1 134628685 missense probably damaging 1.00
R0233:Kdm5b UTSW 1 134604634 splice site probably benign
R0334:Kdm5b UTSW 1 134604522 missense probably damaging 0.99
R0504:Kdm5b UTSW 1 134621023 critical splice donor site probably null
R0505:Kdm5b UTSW 1 134602571 missense probably damaging 0.96
R1004:Kdm5b UTSW 1 134588904 missense possibly damaging 0.71
R1087:Kdm5b UTSW 1 134600637 missense probably damaging 1.00
R1126:Kdm5b UTSW 1 134613991 missense possibly damaging 0.90
R1221:Kdm5b UTSW 1 134599091 missense probably damaging 0.98
R1230:Kdm5b UTSW 1 134613254 missense probably damaging 1.00
R1345:Kdm5b UTSW 1 134630550 missense possibly damaging 0.94
R1482:Kdm5b UTSW 1 134624897 missense probably damaging 1.00
R1582:Kdm5b UTSW 1 134624853 missense probably damaging 0.99
R1653:Kdm5b UTSW 1 134602481 missense probably damaging 1.00
R1693:Kdm5b UTSW 1 134597576 splice site probably benign
R1721:Kdm5b UTSW 1 134613181 splice site probably benign
R1741:Kdm5b UTSW 1 134618017 missense possibly damaging 0.82
R1762:Kdm5b UTSW 1 134604467 nonsense probably null
R1820:Kdm5b UTSW 1 134597670 missense possibly damaging 0.87
R1872:Kdm5b UTSW 1 134624994 missense probably damaging 1.00
R1966:Kdm5b UTSW 1 134613873 splice site probably null
R2056:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2059:Kdm5b UTSW 1 134613214 missense probably benign 0.05
R2405:Kdm5b UTSW 1 134609016 missense probably damaging 0.97
R3417:Kdm5b UTSW 1 134587977 missense probably damaging 1.00
R3771:Kdm5b UTSW 1 134613345 missense probably damaging 1.00
R3783:Kdm5b UTSW 1 134630542 missense probably benign
R3803:Kdm5b UTSW 1 134615941 missense probably benign 0.07
R3980:Kdm5b UTSW 1 134619670 missense probably benign 0.11
R3983:Kdm5b UTSW 1 134631304 missense possibly damaging 0.91
R4013:Kdm5b UTSW 1 134627329 missense possibly damaging 0.86
R4162:Kdm5b UTSW 1 134625161 missense probably benign 0.01
R4701:Kdm5b UTSW 1 134606012 intron probably benign
R4791:Kdm5b UTSW 1 134630800 missense possibly damaging 0.82
R4836:Kdm5b UTSW 1 134593315 splice site probably null
R4924:Kdm5b UTSW 1 134631351 missense probably benign 0.00
R5135:Kdm5b UTSW 1 134588746 intron probably benign
R5248:Kdm5b UTSW 1 134620997 missense probably benign 0.11
R5290:Kdm5b UTSW 1 134622099 splice site probably null
R5358:Kdm5b UTSW 1 134607694 nonsense probably null
R5388:Kdm5b UTSW 1 134608897 nonsense probably null
R5396:Kdm5b UTSW 1 134622098 splice site probably null
R5397:Kdm5b UTSW 1 134622098 splice site probably null
R5398:Kdm5b UTSW 1 134622098 splice site probably null
R5399:Kdm5b UTSW 1 134622098 splice site probably null
R5529:Kdm5b UTSW 1 134588003 missense probably damaging 1.00
R5540:Kdm5b UTSW 1 134631241 missense probably damaging 0.98
R5661:Kdm5b UTSW 1 134599073 missense probably benign 0.01
R5663:Kdm5b UTSW 1 134630635 missense probably benign
R5822:Kdm5b UTSW 1 134588773 splice site probably benign
R6226:Kdm5b UTSW 1 134608878 missense probably damaging 0.99
R6368:Kdm5b UTSW 1 134599207 missense probably damaging 1.00
R6681:Kdm5b UTSW 1 134613269 missense possibly damaging 0.90
R6715:Kdm5b UTSW 1 134609061 critical splice donor site probably null
R7132:Kdm5b UTSW 1 134599106 missense probably damaging 1.00
R7202:Kdm5b UTSW 1 134624759 missense probably benign
R7258:Kdm5b UTSW 1 134621021 missense probably damaging 1.00
R7335:Kdm5b UTSW 1 134560439 missense probably damaging 1.00
R7420:Kdm5b UTSW 1 134604497 missense probably benign 0.14
R7426:Kdm5b UTSW 1 134595833 missense probably benign 0.02
R7452:Kdm5b UTSW 1 134624948 missense probably damaging 1.00
R7595:Kdm5b UTSW 1 134608966 missense probably benign 0.00
R7612:Kdm5b UTSW 1 134624918 nonsense probably null
R7704:Kdm5b UTSW 1 134587931 missense probably damaging 1.00
R7846:Kdm5b UTSW 1 134617840 missense probably damaging 1.00
R8115:Kdm5b UTSW 1 134619673 missense possibly damaging 0.83
R8146:Kdm5b UTSW 1 134625126 missense probably benign 0.05
R8160:Kdm5b UTSW 1 134613919 missense probably damaging 1.00
R8527:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8542:Kdm5b UTSW 1 134605774 missense possibly damaging 0.78
R8930:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8932:Kdm5b UTSW 1 134616272 missense probably damaging 1.00
R8950:Kdm5b UTSW 1 134613926 missense possibly damaging 0.84
R9089:Kdm5b UTSW 1 134607768 missense probably damaging 0.98
R9109:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9133:Kdm5b UTSW 1 134602585 missense probably benign
R9298:Kdm5b UTSW 1 134600755 critical splice donor site probably null
R9423:Kdm5b UTSW 1 134587967 missense possibly damaging 0.85
R9630:Kdm5b UTSW 1 134585233 critical splice donor site probably null
R9670:Kdm5b UTSW 1 134630502 nonsense probably null
X0063:Kdm5b UTSW 1 134588876 missense probably benign 0.07
Z1176:Kdm5b UTSW 1 134625035 missense probably damaging 1.00
Z1177:Kdm5b UTSW 1 134595798 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTGGAAGAGGTTCAGCAGGCT -3'
(R):5'- CGCGTCAACTCTCAGACATTTGATTTG -3'

Sequencing Primer
(F):5'- CTTGCCTGGACTCCAGC -3'
(R):5'- acctcacactcacagcaatc -3'
Posted On 2013-06-12