Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Vmn2r103'

485043

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r103

Ensembl Gene

ENSMUSG00000091771

Gene Name

vomeronasal 2, receptor 103

Synonyms

EG627636

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19773363-19812536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 19812325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 787 (C787F)

Ref Sequence

ENSEMBL: ENSMUSP00000126756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172203]

AlphaFold

E9PWW0

Predicted Effect

probably damaging
Transcript: ENSMUST00000172203
AA Change: C787F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: C787F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	449	1.3e-37	PFAM
Pfam:NCD3G	509	562	3.5e-22	PFAM
Pfam:7tm_3	595	830	1.1e-51	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Vmn2r103

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Vmn2r103	APN	17	19793102	missense	probably damaging	0.98
IGL00939:Vmn2r103	APN	17	19794965	missense	probably benign	0.00
IGL01120:Vmn2r103	APN	17	19792997	missense	probably benign	0.06
IGL01403:Vmn2r103	APN	17	19792967	missense	probably benign
IGL01404:Vmn2r103	APN	17	19812434	missense	probably damaging	1.00
IGL01713:Vmn2r103	APN	17	19794068	missense	probably damaging	1.00
IGL01802:Vmn2r103	APN	17	19799208	missense	probably benign
IGL02251:Vmn2r103	APN	17	19793969	missense	possibly damaging	0.84
IGL02466:Vmn2r103	APN	17	19773369	missense	probably benign
IGL02555:Vmn2r103	APN	17	19811611	missense	probably damaging	1.00
IGL02668:Vmn2r103	APN	17	19794127	missense	probably benign	0.03
IGL02715:Vmn2r103	APN	17	19793956	missense	probably damaging	0.97
IGL02735:Vmn2r103	APN	17	19812248	missense	probably benign	0.27
IGL03101:Vmn2r103	APN	17	19773520	missense	probably damaging	0.98
R0003:Vmn2r103	UTSW	17	19811979	missense	probably damaging	0.99
R0052:Vmn2r103	UTSW	17	19811641	missense	probably benign	0.01
R0375:Vmn2r103	UTSW	17	19792859	missense	probably benign	0.06
R0375:Vmn2r103	UTSW	17	19793464	missense	probably benign	0.12
R0755:Vmn2r103	UTSW	17	19773568	missense	probably benign	0.01
R0837:Vmn2r103	UTSW	17	19793927	missense	probably damaging	0.99
R1345:Vmn2r103	UTSW	17	19794247	missense	probably damaging	1.00
R1396:Vmn2r103	UTSW	17	19792968	missense	probably benign
R1488:Vmn2r103	UTSW	17	19793660	missense	probably damaging	0.97
R1533:Vmn2r103	UTSW	17	19773400	missense	probably benign	0.01
R1590:Vmn2r103	UTSW	17	19794234	missense	probably benign
R1928:Vmn2r103	UTSW	17	19811767	missense	possibly damaging	0.95
R1942:Vmn2r103	UTSW	17	19812300	missense	probably benign	0.02
R2071:Vmn2r103	UTSW	17	19793794	missense	probably benign
R2219:Vmn2r103	UTSW	17	19793647	missense	probably damaging	1.00
R2442:Vmn2r103	UTSW	17	19773531	missense	probably benign	0.00
R2889:Vmn2r103	UTSW	17	19793600	missense	probably damaging	1.00
R3762:Vmn2r103	UTSW	17	19812149	missense	probably damaging	0.98
R4014:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R4331:Vmn2r103	UTSW	17	19794233	missense	probably benign	0.00
R4630:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4631:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4632:Vmn2r103	UTSW	17	19793696	missense	probably benign	0.04
R4660:Vmn2r103	UTSW	17	19811815	missense	probably damaging	1.00
R4801:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4802:Vmn2r103	UTSW	17	19795076	missense	probably benign	0.06
R4931:Vmn2r103	UTSW	17	19811769	missense	probably benign	0.01
R4995:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R5309:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5312:Vmn2r103	UTSW	17	19793034	missense	probably benign	0.01
R5329:Vmn2r103	UTSW	17	19812171	missense	probably damaging	1.00
R5611:Vmn2r103	UTSW	17	19793642	missense	probably damaging	0.99
R5684:Vmn2r103	UTSW	17	19792989	missense	probably benign	0.02
R5715:Vmn2r103	UTSW	17	19794939	missense	probably benign	0.17
R5907:Vmn2r103	UTSW	17	19812453	missense	possibly damaging	0.67
R6029:Vmn2r103	UTSW	17	19794216	nonsense	probably null
R6285:Vmn2r103	UTSW	17	19812144	missense	probably benign
R6292:Vmn2r103	UTSW	17	19793604	missense	possibly damaging	0.67
R6334:Vmn2r103	UTSW	17	19794082	missense	probably damaging	0.97
R6501:Vmn2r103	UTSW	17	19811904	missense	probably benign	0.29
R6710:Vmn2r103	UTSW	17	19811977	missense	probably damaging	1.00
R6774:Vmn2r103	UTSW	17	19773511	missense	probably benign	0.14
R6981:Vmn2r103	UTSW	17	19793477	missense	probably benign	0.00
R7768:Vmn2r103	UTSW	17	19812052	missense	probably damaging	0.99
R7816:Vmn2r103	UTSW	17	19794214	missense	probably benign	0.06
R7885:Vmn2r103	UTSW	17	19793123	missense	probably benign	0.25
R8002:Vmn2r103	UTSW	17	19799249	missense	probably damaging	1.00
R8031:Vmn2r103	UTSW	17	19793497	missense	probably benign	0.00
R8140:Vmn2r103	UTSW	17	19811796	missense	probably damaging	1.00
R8186:Vmn2r103	UTSW	17	19811943	missense	probably damaging	1.00
R8559:Vmn2r103	UTSW	17	19812384	missense	probably benign	0.01
R9413:Vmn2r103	UTSW	17	19811896	missense	possibly damaging	0.54
R9591:Vmn2r103	UTSW	17	19811659	missense	possibly damaging	0.70
R9652:Vmn2r103	UTSW	17	19793765	missense	probably benign	0.01
R9680:Vmn2r103	UTSW	17	19799263	nonsense	probably null
R9743:Vmn2r103	UTSW	17	19812213	missense	probably damaging	1.00
Z1088:Vmn2r103	UTSW	17	19795047	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GGATGACAACTTCTCCACCATTC -3'
(R):5'- TTCTTCCGCACATGAGTAAATG -3'

Sequencing Primer
(F):5'- AGATGCTCATACTGAACATGGAC -3'
(R):5'- CCGCACATGAGTAAATGAATTGTTC -3'

Posted On

2017-08-16