Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Sox8'

485045

Institutional Source

Beutler Lab

Gene Symbol

Sox8

Ensembl Gene

ENSMUSG00000024176

Gene Name

SRY (sex determining region Y)-box 8

Synonyms

MMRRC Submission

044263-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25565892-25570686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25567520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 403 (D403G)

Ref Sequence

ENSEMBL: ENSMUSP00000025003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025003] [ENSMUST00000173447]

AlphaFold

Q04886

Predicted Effect

probably damaging
Transcript: ENSMUST00000025003
AA Change: D403G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025003
Gene: ENSMUSG00000024176
AA Change: D403G

Domain	Start	End	E-Value	Type
Pfam:Sox_N	18	86	3.8e-27	PFAM
HMG	98	168	3.86e-28	SMART
low complexity region	208	228	N/A	INTRINSIC
low complexity region	303	321	N/A	INTRINSIC
low complexity region	375	397	N/A	INTRINSIC
low complexity region	407	425	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163493

Predicted Effect

probably benign
Transcript: ENSMUST00000173447

SMART Domains

Protein: ENSMUSP00000133403
Gene: ENSMUSG00000024176

Domain	Start	End	E-Value	Type
Pfam:Sox_N	3	87	3.3e-25	PFAM
HMG	98	168	3.86e-28	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174560

SMART Domains

Protein: ENSMUSP00000133742
Gene: ENSMUSG00000024176

Domain	Start	End	E-Value	Type
HMG	1	66	1.19e-19	SMART

Meta Mutation Damage Score

0.4462

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein may be involved in brain development and function. Haploinsufficiency for this protein may contribute to the mental retardation found in haemoglobin H-related mental retardation (ART-16 syndrome). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a 30% decrease in adult body weight due to diminished fat stores, and a reduction of several tarsals which subsequently fail to fuse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Svil	T	C	18: 5,108,639	S1522P	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Sox8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01417:Sox8	APN	17	25567528	splice site	probably null
IGL01918:Sox8	APN	17	25570137	missense	probably damaging	1.00
IGL02672:Sox8	APN	17	25568989	missense	probably damaging	1.00
IGL03371:Sox8	APN	17	25567440	missense	probably damaging	1.00
R1398:Sox8	UTSW	17	25567883	missense	probably benign	0.01
R1673:Sox8	UTSW	17	25567482	missense	possibly damaging	0.77
R1742:Sox8	UTSW	17	25567941	missense	probably damaging	0.99
R4019:Sox8	UTSW	17	25570297	missense	probably damaging	1.00
R4353:Sox8	UTSW	17	25567335	makesense	probably null
R4466:Sox8	UTSW	17	25568905	missense	probably benign	0.37
R4893:Sox8	UTSW	17	25568989	missense	probably damaging	1.00
R4929:Sox8	UTSW	17	25570356	missense	probably benign	0.21
R5915:Sox8	UTSW	17	25567469	missense	probably damaging	1.00
R6915:Sox8	UTSW	17	25567914	missense	probably damaging	1.00
R7030:Sox8	UTSW	17	25570108	critical splice donor site	probably null
R7232:Sox8	UTSW	17	25567540	missense	probably benign	0.01
R7549:Sox8	UTSW	17	25567961	missense	probably damaging	0.99
R8262:Sox8	UTSW	17	25567643	missense	possibly damaging	0.89
R8862:Sox8	UTSW	17	25568071	missense	possibly damaging	0.81
R9015:Sox8	UTSW	17	25570161	missense	probably damaging	1.00
R9109:Sox8	UTSW	17	25568839	missense	possibly damaging	0.94
R9387:Sox8	UTSW	17	25567364	missense	probably damaging	1.00
R9406:Sox8	UTSW	17	25567660	missense	probably damaging	1.00
Z1177:Sox8	UTSW	17	25567743	missense	probably benign	0.00
Z1177:Sox8	UTSW	17	25568984	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAACTCAAAGATCTGGCTAGACTTC -3'
(R):5'- TTCGGCCACAGATCAAGAC -3'

Sequencing Primer
(F):5'- TAGACTTCCTGGATGCAGCAG -3'
(R):5'- ACGGAGCAGCTGAGTCCTAG -3'

Posted On

2017-08-16