Mutagenetix > Incidental Mutation

Incidental Mutation 'R6114:Svil'

485049

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

044263-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R6114 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5108639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1522 (S1522P)

Ref Sequence

ENSEMBL: ENSMUSP00000119287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

AlphaFold

Q8K4L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000025079
AA Change: S1926P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: S1926P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000126977
AA Change: S1926P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: S1926P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127297
AA Change: S1812P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: S1812P

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131609
AA Change: S1926P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: S1926P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000140448
AA Change: S1926P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: S1926P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143254
AA Change: S1522P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: S1522P

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146723

SMART Domains

Protein: ENSMUSP00000115591
Gene: ENSMUSG00000024236

Domain	Start	End	E-Value	Type
Blast:GEL	2	37	1e-17	BLAST
SCOP:d1d0na6	53	168	3e-19	SMART
Blast:GEL	63	169	1e-72	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000210707
AA Change: S2013P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

94% (60/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamdec1	C	A	14: 68,571,803	V237L	probably benign	Het
Aff1	T	C	5: 103,842,297	S878P	probably damaging	Het
Ahcy	A	C	2: 155,062,159	L386R	probably damaging	Het
Ank2	T	C	3: 127,011,051	N607D	probably damaging	Het
Arid5b	T	C	10: 68,097,744	D776G	possibly damaging	Het
Art4	T	A	6: 136,857,213	T11S	unknown	Het
Blm	T	C	7: 80,513,487	T39A	probably damaging	Het
Cabin1	T	A	10: 75,747,971	M221L	probably benign	Het
Cacna1c	T	C	6: 118,596,140	T1675A	probably benign	Het
Cacnb2	A	T	2: 14,975,201	H285L	possibly damaging	Het
Cchcr1	A	G	17: 35,525,330	E339G	probably damaging	Het
Cd14	A	G	18: 36,725,953	W150R	probably damaging	Het
Cep162	A	G	9: 87,203,710	I1187T	probably benign	Het
Cntnap4	A	G	8: 112,841,753	H807R	probably damaging	Het
Copb1	T	A	7: 114,246,801	H178L	probably benign	Het
Cpxm2	A	G	7: 132,154,306	V103A	probably benign	Het
Egfr	A	G	11: 16,904,374	T849A	possibly damaging	Het
Endou	T	A	15: 97,713,876	K294*	probably null	Het
Fam208b	G	A	13: 3,590,081	T352M	probably damaging	Het
Gm884	T	A	11: 103,617,791		probably benign	Het
Hoxd9	A	G	2: 74,699,365	N322D	probably damaging	Het
Hsph1	C	A	5: 149,627,387	V416L	possibly damaging	Het
Igkv4-78	T	A	6: 69,059,759	T97S	possibly damaging	Het
Itga10	G	T	3: 96,649,035	C162F	probably damaging	Het
Lmod2	A	G	6: 24,603,692	E222G	probably damaging	Het
Lpar5	A	G	6: 125,081,676	N120S	probably damaging	Het
Lrrk2	A	G	15: 91,747,826	I1318V	probably benign	Het
Lst1	T	C	17: 35,188,360	T11A	possibly damaging	Het
Mfn1	C	A	3: 32,563,836	A106D	probably damaging	Het
Ms4a12	G	T	19: 11,215,290	N227K	probably benign	Het
Nr1h4	T	A	10: 89,478,816	N273Y	possibly damaging	Het
Nrd1	A	T	4: 109,044,585	K617M	probably damaging	Het
Olfr355	A	T	2: 36,927,689	C142S	possibly damaging	Het
Olfr516	A	T	7: 108,845,386	M208K	possibly damaging	Het
Olfr771	T	A	10: 129,160,333	H217L	probably benign	Het
Pcdhgc3	C	G	18: 37,807,872	T442R	probably benign	Het
Pcnx2	T	C	8: 125,773,947	N1468S	probably damaging	Het
Pde2a	A	T	7: 101,511,112		probably null	Het
Pitx2	C	G	3: 129,204,413		probably null	Het
Reck	T	A	4: 43,922,895	I390N	probably damaging	Het
Rora	A	G	9: 69,371,323	N254S	probably benign	Het
Samd4b	A	G	7: 28,522,792		probably null	Het
Scn8a	A	G	15: 101,040,596	T1949A	probably damaging	Het
Slc22a15	A	T	3: 101,860,852	Y346*	probably null	Het
Slc24a5	A	G	2: 125,083,092	T218A	probably benign	Het
Slc38a10	G	A	11: 120,129,312	Q305*	probably null	Het
Slc45a4	G	A	15: 73,605,604	P28S	probably damaging	Het
Smyd5	A	T	6: 85,440,262		probably benign	Het
Sox8	T	C	17: 25,567,520	D403G	probably damaging	Het
Stx7	A	G	10: 24,184,985		probably null	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tcf25	A	T	8: 123,384,375	K192M	probably damaging	Het
Tecpr1	C	T	5: 144,204,640	G804S	possibly damaging	Het
Teddm1a	C	G	1: 153,891,868	S26C	probably damaging	Het
Usp13	C	T	3: 32,854,669	P155S	probably damaging	Het
Usp17lb	T	A	7: 104,840,364	D451V	possibly damaging	Het
Vmn1r173	A	G	7: 23,702,829	N163S	possibly damaging	Het
Vmn2r103	G	T	17: 19,812,325	C787F	probably damaging	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Wdr24	C	T	17: 25,824,605	H134Y	probably benign	Het
Zbtb40	T	A	4: 136,988,691	I988F	probably damaging	Het
Zfp536	A	T	7: 37,479,736	I84N	probably damaging	Het
Zfp651	T	A	9: 121,765,595	F540Y	probably damaging	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
R3779_Svil_985	UTSW	18	5090855	missense	probably damaging	0.97
R5433_Svil_176	UTSW	18	5059294	missense	probably damaging	0.99
R6062_Svil_873	UTSW	18	5106724	missense	probably damaging	1.00
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8752:Svil	UTSW	18	5060366	intron	probably benign
R8774:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8774-TAIL:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8780:Svil	UTSW	18	5063449	missense	probably benign	0.00
R8787:Svil	UTSW	18	5059332	nonsense	probably null
R8790:Svil	UTSW	18	5056098	missense	possibly damaging	0.82
R8974:Svil	UTSW	18	5099650	missense	probably damaging	1.00
R9029:Svil	UTSW	18	5056239	missense	probably benign
R9072:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9073:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9079:Svil	UTSW	18	5056308	missense	probably benign	0.31
R9181:Svil	UTSW	18	5090833	missense	possibly damaging	0.75
R9363:Svil	UTSW	18	5037155	missense	probably benign	0.02
R9377:Svil	UTSW	18	5057294	missense	probably benign	0.06
R9381:Svil	UTSW	18	5099013	missense	probably benign	0.06
R9389:Svil	UTSW	18	5090811	missense	possibly damaging	0.52
R9566:Svil	UTSW	18	5099661	missense	probably damaging	1.00
R9607:Svil	UTSW	18	5058126	missense	possibly damaging	0.92
R9716:Svil	UTSW	18	5062370	missense	probably damaging	1.00
R9801:Svil	UTSW	18	5049062	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTCTTTAGCTAGAGAGTGAAGT -3'
(R):5'- GTGTGAATGCATTCGTGAAGAG -3'

Sequencing Primer
(F):5'- CTTTAGCTAGAGAGTGAAGTCATCCG -3'
(R):5'- ACTTCCTTGGTGATGAACAGC -3'

Posted On

2017-08-16