Incidental Mutation 'R6115:Yod1'
ID485054
Institutional Source Beutler Lab
Gene Symbol Yod1
Ensembl Gene ENSMUSG00000046404
Gene NameYOD1 deubiquitinase
Synonyms9930028C20Rik
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location130717327-130724358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130719063 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 226 (F226L)
Ref Sequence ENSEMBL: ENSMUSP00000055318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049813] [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
PDB Structure Solution NMR Structure of Ubiquitin thioesterase OTU1 (EC 3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049813
AA Change: F226L

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000055318
Gene: ENSMUSG00000046404
AA Change: F226L

DomainStartEndE-ValueType
PDB:2KZR|A 42 127 3e-54 PDB
Blast:UBQ 43 118 2e-20 BLAST
Pfam:OTU 150 268 3.4e-8 PFAM
ZnF_C2H2 313 337 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050406
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066863
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169659
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171479
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185233
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably benign
Transcript: ENSMUST00000187089
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188520
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189167
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189534
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191301
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191347
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Meta Mutation Damage Score 0.1799 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Yod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Yod1 APN 1 130719133 missense probably damaging 1.00
IGL02321:Yod1 APN 1 130718951 missense probably damaging 1.00
IGL03018:Yod1 APN 1 130718958 missense probably benign 0.08
R1310:Yod1 UTSW 1 130718830 missense probably benign
R5825:Yod1 UTSW 1 130719006 missense probably damaging 1.00
R6367:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6437:Yod1 UTSW 1 130719148 missense probably damaging 1.00
R6489:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6491:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6729:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6731:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6732:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6742:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6743:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6766:Yod1 UTSW 1 130719271 nonsense probably null
R6781:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R7831:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R8058:Yod1 UTSW 1 130719069 nonsense probably null
R8369:Yod1 UTSW 1 130717623 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAGGAGGAGTCTTGAATCCAGC -3'
(R):5'- GCTTCATCAGCTAATTCCAGTGC -3'

Sequencing Primer
(F):5'- GAGTCTTGAATCCAGCTTGTGCC -3'
(R):5'- CAGCTAATTCCAGTGCTTGTACAAG -3'
Posted On2017-08-16