Incidental Mutation 'R6115:Lmx1b'
ID485055
Institutional Source Beutler Lab
Gene Symbol Lmx1b
Ensembl Gene ENSMUSG00000038765
Gene NameLIM homeobox transcription factor 1 beta
SynonymsIcst, LMX1.2, GENA 191
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location33560965-33640511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33569106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 145 (D145G)
Ref Sequence ENSEMBL: ENSMUSP00000043616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041730]
Predicted Effect probably damaging
Transcript: ENSMUST00000041730
AA Change: D145G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043616
Gene: ENSMUSG00000038765
AA Change: D145G

DomainStartEndE-ValueType
LIM 32 83 4.48e-17 SMART
LIM 91 145 5.51e-17 SMART
low complexity region 151 172 N/A INTRINSIC
HOX 196 258 1.51e-21 SMART
low complexity region 259 272 N/A INTRINSIC
low complexity region 328 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137559
SMART Domains Protein: ENSMUSP00000115288
Gene: ENSMUSG00000038765

DomainStartEndE-ValueType
LIM 9 63 5.51e-17 SMART
low complexity region 69 90 N/A INTRINSIC
low complexity region 95 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176067
AA Change: D134G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134944
Gene: ENSMUSG00000038765
AA Change: D134G

DomainStartEndE-ValueType
LIM 1 38 2.23e-3 SMART
LIM 46 100 5.51e-17 SMART
low complexity region 106 127 N/A INTRINSIC
HOX 151 213 1.51e-21 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 290 302 N/A INTRINSIC
Meta Mutation Damage Score 0.6996 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various skeletal, kidney, and eye defects. Pups also fail to suckle. Heterozygous mice with a homeodomain V265D mutation exhibit a variety of eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Lmx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Lmx1b APN 2 33639498 missense possibly damaging 0.95
IGL01583:Lmx1b APN 2 33569059 missense probably benign 0.04
IGL02885:Lmx1b APN 2 33567204 missense probably benign 0.10
R1926:Lmx1b UTSW 2 33564662 missense probably damaging 1.00
R3056:Lmx1b UTSW 2 33567285 nonsense probably null
R3522:Lmx1b UTSW 2 33639531 missense probably benign 0.01
R3957:Lmx1b UTSW 2 33569094 missense probably damaging 0.99
R4888:Lmx1b UTSW 2 33564790 missense probably benign 0.01
RF032:Lmx1b UTSW 2 33640489 nonsense probably null
RF035:Lmx1b UTSW 2 33640489 nonsense probably null
RF038:Lmx1b UTSW 2 33640509 start codon destroyed probably null
RF043:Lmx1b UTSW 2 33640509 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGACACCTTGATGCTGGCTG -3'
(R):5'- TAGTGGCTTCCATCCTGAGCAG -3'

Sequencing Primer
(F):5'- TGGCCATGCACGGACATG -3'
(R):5'- GGTAGAGCTGACCACCCAAG -3'
Posted On2017-08-16