Incidental Mutation 'R6115:Fign'
ID485058
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Namefidgetin
Synonyms
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location63971507-64098038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63979310 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 539 (I539V)
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126042
Predicted Effect probably benign
Transcript: ENSMUST00000131615
AA Change: I539V

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324
AA Change: I539V

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153538
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Fign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Fign APN 2 63979010 missense probably damaging 0.99
IGL01149:Fign APN 2 63979760 missense possibly damaging 0.92
IGL01328:Fign APN 2 63978872 missense probably damaging 0.97
IGL01448:Fign APN 2 63979688 missense probably damaging 0.97
IGL01680:Fign APN 2 63978644 utr 3 prime probably benign
IGL01989:Fign APN 2 63980450 missense probably benign
IGL02010:Fign APN 2 63980400 missense probably damaging 0.98
IGL02092:Fign APN 2 63980583 missense possibly damaging 0.95
IGL02252:Fign APN 2 63980639 missense probably benign 0.14
IGL02455:Fign APN 2 63980497 missense probably benign 0.22
IGL02541:Fign APN 2 63979537 missense probably benign 0.38
IGL03109:Fign APN 2 63980662 missense possibly damaging 0.83
R0534:Fign UTSW 2 63980791 missense probably damaging 0.96
R0630:Fign UTSW 2 63980141 missense possibly damaging 0.86
R1678:Fign UTSW 2 63980374 missense probably damaging 0.99
R2512:Fign UTSW 2 63979799 missense probably benign 0.03
R3125:Fign UTSW 2 63978700 missense possibly damaging 0.94
R4679:Fign UTSW 2 63979261 missense probably damaging 1.00
R4735:Fign UTSW 2 63980438 missense probably damaging 1.00
R4753:Fign UTSW 2 63979019 missense probably benign 0.04
R5071:Fign UTSW 2 63979693 nonsense probably null
R5072:Fign UTSW 2 63979693 nonsense probably null
R5073:Fign UTSW 2 63979693 nonsense probably null
R5074:Fign UTSW 2 63979693 nonsense probably null
R5344:Fign UTSW 2 63979225 missense probably benign 0.01
R5427:Fign UTSW 2 63978998 missense probably damaging 1.00
R5922:Fign UTSW 2 63979060 missense probably damaging 0.99
R6373:Fign UTSW 2 63979645 missense probably benign 0.06
R6542:Fign UTSW 2 63980295 missense possibly damaging 0.53
R6637:Fign UTSW 2 64027908 intron probably benign
R6858:Fign UTSW 2 63979813 missense probably benign 0.02
R7188:Fign UTSW 2 63979606 missense possibly damaging 0.95
R7309:Fign UTSW 2 63979957 missense possibly damaging 0.77
R7429:Fign UTSW 2 63979060 missense probably damaging 0.99
R7430:Fign UTSW 2 63979060 missense probably damaging 0.99
R7608:Fign UTSW 2 63978719 missense possibly damaging 0.75
R7642:Fign UTSW 2 63980572 missense probably benign 0.16
R7782:Fign UTSW 2 63979162 missense probably damaging 1.00
R8775:Fign UTSW 2 63980547 missense probably benign 0.32
R8775-TAIL:Fign UTSW 2 63980547 missense probably benign 0.32
R8939:Fign UTSW 2 63979112 missense probably benign 0.37
X0028:Fign UTSW 2 63980851 missense probably damaging 1.00
Z1088:Fign UTSW 2 64096902 missense probably benign 0.01
Z1177:Fign UTSW 2 63979385 missense probably damaging 1.00
Z1177:Fign UTSW 2 63979690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTCCTCGCTCACTTGAGAG -3'
(R):5'- CACACCTCATTGACCTGGTC -3'

Sequencing Primer
(F):5'- CTCGCTCACTTGAGAGGAGAG -3'
(R):5'- TTGACCTGGTCACCAATGAG -3'
Posted On2017-08-16