Incidental Mutation 'R6115:Olfr1281'
ID485060
Institutional Source Beutler Lab
Gene Symbol Olfr1281
Ensembl Gene ENSMUSG00000095156
Gene Nameolfactory receptor 1281
SynonymsGA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111326520-111332852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111329213 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 265 (T265A)
Ref Sequence ENSEMBL: ENSMUSP00000151304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090326] [ENSMUST00000208176] [ENSMUST00000213551]
Predicted Effect probably benign
Transcript: ENSMUST00000090326
AA Change: T265A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156
AA Change: T265A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 301 2.6e-6 PFAM
Pfam:7tm_1 41 287 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208176
AA Change: T265A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000213551
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Olfr1281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Olfr1281 APN 2 111328575 missense probably damaging 1.00
IGL02550:Olfr1281 APN 2 111328500 missense probably damaging 1.00
IGL02553:Olfr1281 APN 2 111328988 missense probably benign
IGL02719:Olfr1281 APN 2 111329245 nonsense probably null
IGL02750:Olfr1281 APN 2 111329288 missense probably damaging 1.00
IGL02873:Olfr1281 APN 2 111328872 missense probably benign
IGL03252:Olfr1281 APN 2 111328780 nonsense probably null
IGL03375:Olfr1281 APN 2 111328884 missense probably damaging 1.00
R0055:Olfr1281 UTSW 2 111328525 nonsense probably null
R0368:Olfr1281 UTSW 2 111328787 missense probably damaging 0.99
R0497:Olfr1281 UTSW 2 111328830 missense probably benign 0.00
R0505:Olfr1281 UTSW 2 111329328 missense probably benign 0.00
R1557:Olfr1281 UTSW 2 111328619 missense probably damaging 1.00
R1619:Olfr1281 UTSW 2 111328961 missense probably benign 0.02
R1691:Olfr1281 UTSW 2 111328853 missense probably benign 0.03
R2286:Olfr1281 UTSW 2 111328907 missense probably benign 0.01
R4230:Olfr1281 UTSW 2 111329130 missense probably damaging 1.00
R4274:Olfr1281 UTSW 2 111328815 missense probably damaging 0.98
R4305:Olfr1281 UTSW 2 111329298 missense probably null 0.82
R4495:Olfr1281 UTSW 2 111329020 missense probably benign 0.08
R5307:Olfr1281 UTSW 2 111328396 splice site probably null
R6615:Olfr1281 UTSW 2 111329112 missense probably benign 0.00
R7169:Olfr1281 UTSW 2 111328598 missense probably damaging 1.00
R7601:Olfr1281 UTSW 2 111329220 missense probably benign 0.12
R8267:Olfr1281 UTSW 2 111328815 missense probably benign 0.22
R8447:Olfr1281 UTSW 2 111328962 missense possibly damaging 0.81
R8749:Olfr1281 UTSW 2 111328472 missense possibly damaging 0.93
R8795:Olfr1281 UTSW 2 111328536 nonsense probably null
Z1177:Olfr1281 UTSW 2 111328825 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACAGTGGCATTTTAGCAAC -3'
(R):5'- CAGTTAAGAATAGCTTGCAGAGATG -3'

Sequencing Primer
(F):5'- GGCATTTTAGCAACTTCTTGTTTCAC -3'
(R):5'- TTTGAAGTCAAGATGAATCTAAAGGG -3'
Posted On2017-08-16