Incidental Mutation 'R6115:Olfr1299'
ID485061
Institutional Source Beutler Lab
Gene Symbol Olfr1299
Ensembl Gene ENSMUSG00000109219
Gene Nameolfactory receptor 1299
SynonymsGA_x6K02T2Q125-72715642-72716580, MOR248-8
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111661419-111665814 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 111664642 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 139 (K139*)
Ref Sequence ENSEMBL: ENSMUSP00000149299 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000207228
AA Change: K139*
Predicted Effect probably benign
Transcript: ENSMUST00000208175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208983
Predicted Effect probably null
Transcript: ENSMUST00000213511
AA Change: K139*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Olfr1299
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr1299 APN 2 111665144 missense probably benign 0.00
IGL02090:Olfr1299 APN 2 111664988 missense probably damaging 0.99
IGL02213:Olfr1299 APN 2 111664675 missense probably benign 0.05
R0603:Olfr1299 UTSW 2 111664880 missense probably damaging 1.00
R1598:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1802:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1803:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1885:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1887:Olfr1299 UTSW 2 111664754 missense probably damaging 1.00
R1962:Olfr1299 UTSW 2 111664889 missense probably damaging 1.00
R2024:Olfr1299 UTSW 2 111664823 missense possibly damaging 0.53
R2438:Olfr1299 UTSW 2 111664751 missense probably damaging 1.00
R5132:Olfr1299 UTSW 2 111664999 missense probably damaging 1.00
R5938:Olfr1299 UTSW 2 111664363 missense probably benign
R6336:Olfr1299 UTSW 2 111664619 missense possibly damaging 0.81
R6418:Olfr1299 UTSW 2 111664472 missense probably benign 0.00
R7196:Olfr1299 UTSW 2 111664697 missense probably damaging 0.97
R7539:Olfr1299 UTSW 2 111664433 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTTGGCCAACCTGTCCTTTG -3'
(R):5'- CCAAATCATGGGAATCTGTGCAG -3'

Sequencing Primer
(F):5'- AACCTGTCCTTTGTTGATATATGGC -3'
(R):5'- ATCATGGGAATCTGTGCAGGCTAG -3'
Posted On2017-08-16