Incidental Mutation 'R6115:Herc6'
ID485070
Institutional Source Beutler Lab
Gene Symbol Herc6
Ensembl Gene ENSMUSG00000029798
Gene Namehect domain and RLD 6
SynonymsHerc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6115 (G1)
Quality Score167.009
Status Validated
Chromosome6
Chromosomal Location57581000-57664632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57583206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000031817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031817] [ENSMUST00000203840]
Predicted Effect probably benign
Transcript: ENSMUST00000031817
AA Change: D77G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: D77G

DomainStartEndE-ValueType
Pfam:RCC1 40 89 1.9e-12 PFAM
Pfam:RCC1 92 142 4.8e-17 PFAM
Pfam:RCC1_2 129 158 3.4e-14 PFAM
Pfam:RCC1 145 195 1.6e-18 PFAM
Pfam:RCC1_2 183 211 1e-8 PFAM
Pfam:RCC1 198 250 2e-10 PFAM
Pfam:RCC1_2 237 266 4e-10 PFAM
Pfam:RCC1 253 301 4.8e-9 PFAM
low complexity region 359 373 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
HECTc 677 1003 1.03e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203840
SMART Domains Protein: ENSMUSP00000145505
Gene: ENSMUSG00000029798

DomainStartEndE-ValueType
Pfam:RCC1 40 78 2.2e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204686
Meta Mutation Damage Score 0.1457 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Herc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Herc6 APN 6 57607145 missense probably benign 0.03
IGL00836:Herc6 APN 6 57619549 missense probably damaging 0.98
IGL01289:Herc6 APN 6 57598623 missense probably damaging 1.00
IGL01631:Herc6 APN 6 57604107 missense probably benign 0.03
IGL02656:Herc6 APN 6 57611836 critical splice donor site probably null
IGL02966:Herc6 APN 6 57583333 critical splice donor site probably null
IGL03297:Herc6 APN 6 57662389 missense probably benign 0.03
IGL02835:Herc6 UTSW 6 57646161 missense possibly damaging 0.94
R0218:Herc6 UTSW 6 57619601 missense probably benign 0.00
R0470:Herc6 UTSW 6 57619452 missense probably damaging 1.00
R0699:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0702:Herc6 UTSW 6 57581107 missense probably damaging 1.00
R0707:Herc6 UTSW 6 57662362 missense possibly damaging 0.81
R0850:Herc6 UTSW 6 57583242 missense possibly damaging 0.84
R1067:Herc6 UTSW 6 57662219 missense probably damaging 1.00
R1740:Herc6 UTSW 6 57652065 missense probably benign
R1840:Herc6 UTSW 6 57658106 nonsense probably null
R1889:Herc6 UTSW 6 57662075 nonsense probably null
R1938:Herc6 UTSW 6 57625941 missense probably damaging 1.00
R2024:Herc6 UTSW 6 57583332 missense probably benign 0.04
R2051:Herc6 UTSW 6 57625976 missense probably benign 0.00
R2238:Herc6 UTSW 6 57654401 missense probably benign 0.05
R2244:Herc6 UTSW 6 57598617 nonsense probably null
R4085:Herc6 UTSW 6 57647069 missense probably benign 0.09
R4410:Herc6 UTSW 6 57659679 missense possibly damaging 0.82
R4490:Herc6 UTSW 6 57654495 missense probably damaging 1.00
R4599:Herc6 UTSW 6 57659713 missense probably benign 0.34
R4716:Herc6 UTSW 6 57598438 missense probably damaging 1.00
R4757:Herc6 UTSW 6 57600060 critical splice donor site probably null
R4761:Herc6 UTSW 6 57662900 missense probably benign 0.01
R4798:Herc6 UTSW 6 57604166 missense probably damaging 1.00
R4826:Herc6 UTSW 6 57647087 missense probably benign 0.00
R5520:Herc6 UTSW 6 57647120 missense possibly damaging 0.51
R5545:Herc6 UTSW 6 57658007 critical splice acceptor site probably null
R5664:Herc6 UTSW 6 57618684 missense probably benign
R5763:Herc6 UTSW 6 57662887 missense probably damaging 1.00
R5916:Herc6 UTSW 6 57646203 missense probably benign
R6225:Herc6 UTSW 6 57662154 missense possibly damaging 0.50
R7287:Herc6 UTSW 6 57651980 intron probably null
R7319:Herc6 UTSW 6 57604089 missense probably damaging 1.00
R7375:Herc6 UTSW 6 57651806 intron probably null
R7480:Herc6 UTSW 6 57581221 missense possibly damaging 0.66
R7485:Herc6 UTSW 6 57581104 missense probably benign 0.00
R7670:Herc6 UTSW 6 57660122 missense probably damaging 1.00
R7740:Herc6 UTSW 6 57659817 intron probably null
Z1176:Herc6 UTSW 6 57600031 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTCCTGTCTTAAACTCCAG -3'
(R):5'- CATGGCATTTGAGTACTTAGCAC -3'

Sequencing Primer
(F):5'- TGGAAGGTTTTTCATTTTCTTTTCTC -3'
(R):5'- TAAATTCTCCAATCCCCAGC -3'
Posted On2017-08-16