Incidental Mutation 'R6115:Nsmce4a'
ID485078
Institutional Source Beutler Lab
Gene Symbol Nsmce4a
Ensembl Gene ENSMUSG00000040331
Gene NameNSE4 homolog A, SMC5-SMC6 complex component
Synonyms
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R6115 (G1)
Quality Score218.009
Status Validated
Chromosome7
Chromosomal Location130532526-130573118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130546992 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 95 (Q95K)
Ref Sequence ENSEMBL: ENSMUSP00000125300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124096] [ENSMUST00000160289]
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159694
SMART Domains Protein: ENSMUSP00000124471
Gene: ENSMUSG00000040331

DomainStartEndE-ValueType
Pfam:Nse4-Nse3_bdg 36 94 2.2e-20 PFAM
Pfam:Nse4_C 187 263 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160289
AA Change: Q95K

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125300
Gene: ENSMUSG00000040331
AA Change: Q95K

DomainStartEndE-ValueType
low complexity region 2 50 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
Pfam:Nse4-Nse3_bdg 130 186 6.2e-18 PFAM
Pfam:Nse4_C 282 372 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161414
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Nsmce4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02693:Nsmce4a APN 7 130542808 missense probably damaging 1.00
R0302:Nsmce4a UTSW 7 130545893 critical splice donor site probably benign
R0521:Nsmce4a UTSW 7 130537002 missense probably damaging 1.00
R0529:Nsmce4a UTSW 7 130533806 missense probably benign 0.01
R1378:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R1542:Nsmce4a UTSW 7 130545893 critical splice donor site probably null
R2249:Nsmce4a UTSW 7 130539039 missense probably benign 0.00
R4860:Nsmce4a UTSW 7 130533591 unclassified probably benign
R5240:Nsmce4a UTSW 7 130537024 missense probably damaging 1.00
R5356:Nsmce4a UTSW 7 130537048 missense probably damaging 1.00
R5374:Nsmce4a UTSW 7 130538170 missense probably benign 0.05
R6350:Nsmce4a UTSW 7 130539099 missense probably damaging 0.98
R6451:Nsmce4a UTSW 7 130542749
R7203:Nsmce4a UTSW 7 130539872 missense probably benign 0.00
R7422:Nsmce4a UTSW 7 130533817 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGCTGAGCTCAAGTCACCAC -3'
(R):5'- AAGTTGCAAGGCGAATTGGC -3'

Sequencing Primer
(F):5'- GCTTTTCCAGCCGGCCAC -3'
(R):5'- CGAATTGGCGCGATGTCTG -3'
Posted On2017-08-16