Incidental Mutation 'R6115:F7'
ID485080
Institutional Source Beutler Lab
Gene Symbol F7
Ensembl Gene ENSMUSG00000031443
Gene Namecoagulation factor VII
SynonymsFVII, Cf7
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13026034-13035809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13033958 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 214 (N214K)
Ref Sequence ENSEMBL: ENSMUSP00000033820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033820] [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
Predicted Effect probably benign
Transcript: ENSMUST00000033820
AA Change: N214K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033820
Gene: ENSMUSG00000031443
AA Change: N214K

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
GLA 23 86 5.41e-30 SMART
EGF_CA 87 123 2.58e-8 SMART
EGF 131 169 1.99e0 SMART
Tryp_SPc 193 428 1.14e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033821
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128418
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152034
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent serine protease that plays a critical role in the extrinsic pathway of blood coagulation. Upon contact with tissue factor III (TF III), the encoded protein forms an activated complex termed TF-FVIIa that initiates the coagulation cascade involving other coagulation factors, ultimately resulting in a fibrin clot. Complete lack of the encoded protein in mice results in in perinatal lethality due to bleeding from normal blood vessels. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation developed normally through embryogenesis, and exhibited no vascular defects; however, 70% of homozygous neonates suffered fatal intra-abdominal haemorrhaging and died within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in F7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:F7 APN 8 13028802 missense probably benign 0.11
IGL01012:F7 APN 8 13033409 missense probably damaging 0.99
IGL01461:F7 APN 8 13032245 missense possibly damaging 0.94
IGL01700:F7 APN 8 13028685 missense probably benign 0.02
IGL03105:F7 APN 8 13034001 missense probably null 0.07
IGL03241:F7 APN 8 13028779 missense probably damaging 1.00
BB008:F7 UTSW 8 13035209 missense probably benign
BB018:F7 UTSW 8 13035209 missense probably benign
R0746:F7 UTSW 8 13034740 missense probably benign 0.02
R1587:F7 UTSW 8 13034783 missense possibly damaging 0.95
R1661:F7 UTSW 8 13035209 missense probably benign
R2065:F7 UTSW 8 13035183 missense probably damaging 1.00
R2905:F7 UTSW 8 13034775 missense probably benign 0.02
R4355:F7 UTSW 8 13034774 missense probably benign
R5256:F7 UTSW 8 13030763 missense probably damaging 1.00
R6330:F7 UTSW 8 13035140 missense probably damaging 1.00
R7043:F7 UTSW 8 13033997 missense probably benign
R7452:F7 UTSW 8 13035215 missense probably benign 0.02
R7505:F7 UTSW 8 13028745 missense possibly damaging 0.57
R7931:F7 UTSW 8 13035209 missense probably benign
R8273:F7 UTSW 8 13033981 missense probably benign
R8939:F7 UTSW 8 13028724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTCTACCAGAGCCAGC -3'
(R):5'- CCACTCTTGAAGATATCACCTGG -3'

Sequencing Primer
(F):5'- GTTGTCTACCAGAGCCAGCAGATC -3'
(R):5'- CACCTGGTTAGAGACATTGTCAG -3'
Posted On2017-08-16