Incidental Mutation 'R6115:Rnf170'
ID485081
Institutional Source Beutler Lab
Gene Symbol Rnf170
Ensembl Gene ENSMUSG00000013878
Gene Namering finger protein 170
Synonyms6720407G21Rik
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location26119368-26151790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26125966 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 95 (F95S)
Ref Sequence ENSEMBL: ENSMUSP00000119906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014022] [ENSMUST00000110575] [ENSMUST00000110579] [ENSMUST00000124757] [ENSMUST00000131138] [ENSMUST00000140819] [ENSMUST00000153528] [ENSMUST00000209300] [ENSMUST00000209707]
Predicted Effect probably benign
Transcript: ENSMUST00000014022
AA Change: F95S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000014022
Gene: ENSMUSG00000013878
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 157 1.06e-8 SMART
Pfam:DUF1232 230 267 4.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110573
SMART Domains Protein: ENSMUSP00000106202
Gene: ENSMUSG00000013878

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110575
AA Change: F95S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106204
Gene: ENSMUSG00000013878
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 163 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110579
AA Change: F95S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106208
Gene: ENSMUSG00000013878
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
RING 115 138 6.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124757
AA Change: F95S

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115588
Gene: ENSMUSG00000013878
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 136 6e-10 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000124867
AA Change: F58S
SMART Domains Protein: ENSMUSP00000115959
Gene: ENSMUSG00000013878
AA Change: F58S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
SCOP:d1fbva4 49 99 9e-7 SMART
Blast:RING 79 100 2e-9 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000131138
AA Change: F95S
SMART Domains Protein: ENSMUSP00000115452
Gene: ENSMUSG00000109850
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000140819
AA Change: F95S

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119906
Gene: ENSMUSG00000013878
AA Change: F95S

DomainStartEndE-ValueType
transmembrane domain 54 73 N/A INTRINSIC
SCOP:d1fbva4 85 135 1e-6 SMART
Blast:RING 115 135 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153528
AA Change: F48S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118689
Gene: ENSMUSG00000013878
AA Change: F48S

DomainStartEndE-ValueType
RING 68 110 1.06e-8 SMART
Pfam:DUF1232 181 221 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209300
AA Change: F95S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000209707
AA Change: F95S

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RING domain-containing protein that resides in the endoplasmic reticulum (ER) membrane. This protein functions as an E3 ubiquitin ligase and mediates ubiquitination and processing of inositol 1,4,5-trisphosphate (IP3) receptors via the ER-associated protein degradation pathway. It is recruited to the activated IP3 receptors by the ERLIN1/ERLIN2 complex to which it is constitutively bound. Mutations in this gene are associated with autosomal dominant sensory ataxia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a null allele develop progressive gait abnormalities that are more pronounced in dark conditions with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Rnf170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Rnf170 APN 8 26125918 missense probably damaging 1.00
IGL02100:Rnf170 APN 8 26123984 missense probably damaging 1.00
R0382:Rnf170 UTSW 8 26125899 splice site probably benign
R1537:Rnf170 UTSW 8 26139048 missense probably benign 0.06
R1663:Rnf170 UTSW 8 26129143 missense probably damaging 1.00
R4788:Rnf170 UTSW 8 26140863 missense probably damaging 0.98
R4940:Rnf170 UTSW 8 26125911 nonsense probably null
R5174:Rnf170 UTSW 8 26129168 missense probably benign 0.22
R5511:Rnf170 UTSW 8 26140999 missense probably damaging 1.00
R6291:Rnf170 UTSW 8 26140964 missense probably damaging 1.00
R7381:Rnf170 UTSW 8 26123848 missense probably benign 0.04
R8138:Rnf170 UTSW 8 26125981 critical splice donor site probably null
R8744:Rnf170 UTSW 8 26129380 missense unknown
R8818:Rnf170 UTSW 8 26139015 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGGTTACATTAACTCACCAGGA -3'
(R):5'- CAAAAGAACATGTGCTTAATCTGAAA -3'

Sequencing Primer
(F):5'- AATGATGTCAGATGCCTGCC -3'
(R):5'- GAGTAAAGCAGCTGATGC -3'
Posted On2017-08-16