Incidental Mutation 'R6115:Adam34'
ID485082
Institutional Source Beutler Lab
Gene Symbol Adam34
Ensembl Gene ENSMUSG00000079058
Gene Namea disintegrin and metallopeptidase domain 34
Synonymstestase 4
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43650309-43710049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43652061 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 182 (Q182H)
Ref Sequence ENSEMBL: ENSMUSP00000148332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110411] [ENSMUST00000212185]
Predicted Effect probably benign
Transcript: ENSMUST00000110411
AA Change: Q182H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106041
Gene: ENSMUSG00000079058
AA Change: Q182H

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 159 5.9e-20 PFAM
Pfam:Reprolysin_5 205 377 1.6e-16 PFAM
Pfam:Reprolysin_4 205 393 3e-12 PFAM
Pfam:Reprolysin 207 397 9.4e-49 PFAM
Pfam:Reprolysin_2 224 389 1e-14 PFAM
Pfam:Reprolysin_3 231 352 2.7e-14 PFAM
DISIN 416 491 3.38e-40 SMART
ACR 492 628 9.18e-62 SMART
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212185
AA Change: Q182H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Adam34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Adam34 APN 8 43652190 missense possibly damaging 0.91
IGL01296:Adam34 APN 8 43651141 missense possibly damaging 0.90
IGL01369:Adam34 APN 8 43651057 missense probably benign 0.00
IGL01933:Adam34 APN 8 43651532 missense probably damaging 1.00
IGL01938:Adam34 APN 8 43651016 missense probably damaging 1.00
IGL02112:Adam34 APN 8 43651138 missense possibly damaging 0.46
IGL02182:Adam34 APN 8 43651753 missense probably benign
IGL02306:Adam34 APN 8 43650485 missense probably benign 0.44
IGL02661:Adam34 APN 8 43651535 missense probably damaging 1.00
IGL02888:Adam34 APN 8 43651573 missense probably damaging 1.00
IGL02979:Adam34 APN 8 43651371 missense probably damaging 1.00
IGL03073:Adam34 APN 8 43650903 missense probably damaging 0.99
PIT4453001:Adam34 UTSW 8 43651312 missense probably damaging 1.00
R0060:Adam34 UTSW 8 43675883 intron probably benign
R0317:Adam34 UTSW 8 43652251 missense probably benign 0.14
R0322:Adam34 UTSW 8 43651921 missense probably benign 0.00
R0427:Adam34 UTSW 8 43652456 missense probably benign 0.15
R0593:Adam34 UTSW 8 43651687 missense possibly damaging 0.87
R0837:Adam34 UTSW 8 43651500 missense probably benign 0.00
R0927:Adam34 UTSW 8 43651584 missense probably damaging 1.00
R1634:Adam34 UTSW 8 43652090 missense possibly damaging 0.81
R1653:Adam34 UTSW 8 43650645 nonsense probably null
R1826:Adam34 UTSW 8 43651342 missense probably damaging 1.00
R1873:Adam34 UTSW 8 43651806 missense probably benign 0.02
R1943:Adam34 UTSW 8 43650827 missense possibly damaging 0.48
R1943:Adam34 UTSW 8 43651815 missense probably damaging 1.00
R2147:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2150:Adam34 UTSW 8 43652501 missense probably benign 0.01
R2206:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2207:Adam34 UTSW 8 43652237 missense probably benign 0.02
R2268:Adam34 UTSW 8 43650610 missense probably benign 0.00
R2349:Adam34 UTSW 8 43652378 missense probably damaging 0.99
R3983:Adam34 UTSW 8 43650769 missense probably benign
R4158:Adam34 UTSW 8 43650817 missense probably damaging 1.00
R4179:Adam34 UTSW 8 43651091 missense probably benign 0.18
R5219:Adam34 UTSW 8 43651424 missense probably benign
R5398:Adam34 UTSW 8 43651241 missense probably damaging 1.00
R5611:Adam34 UTSW 8 43651712 missense probably benign 0.43
R5928:Adam34 UTSW 8 43652030 missense probably benign 0.08
R6319:Adam34 UTSW 8 43651915 missense probably benign 0.01
R6384:Adam34 UTSW 8 43650799 missense probably benign 0.00
R6706:Adam34 UTSW 8 43651442 nonsense probably null
R6992:Adam34 UTSW 8 43652605 start codon destroyed probably null 1.00
R7032:Adam34 UTSW 8 43652266 missense probably damaging 1.00
R7151:Adam34 UTSW 8 43651462 missense probably benign 0.19
R7187:Adam34 UTSW 8 43652528 missense probably benign 0.02
R7223:Adam34 UTSW 8 43652004 missense probably benign 0.02
R7487:Adam34 UTSW 8 43651154 missense probably damaging 1.00
R7726:Adam34 UTSW 8 43651171 missense probably damaging 0.99
R7789:Adam34 UTSW 8 43652451 missense probably benign 0.00
R7810:Adam34 UTSW 8 43652008 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTCAAAACCACATCAGTCTG -3'
(R):5'- GTCCCTGGTCATTGTCAATACC -3'

Sequencing Primer
(F):5'- GTCAAAACCACATCAGTCTGTATTTG -3'
(R):5'- CAATACCTGTTTTGGAAGTTTGC -3'
Posted On2017-08-16