Incidental Mutation 'R6115:Lrrc49'
ID485086
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Nameleucine rich repeat containing 49
SynonymsD430025H09Rik
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location60568859-60688158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60615161 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 307 (V307E)
Ref Sequence ENSEMBL: ENSMUSP00000109666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053171] [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000150060] [ENSMUST00000166168]
Predicted Effect probably benign
Transcript: ENSMUST00000053171
AA Change: V19E

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000057014
Gene: ENSMUSG00000047766
AA Change: V19E

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000065603
AA Change: V379E

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: V379E

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114032
AA Change: V307E

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766
AA Change: V307E

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114034
AA Change: V313E

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766
AA Change: V313E

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128877
Predicted Effect probably benign
Transcript: ENSMUST00000150060
AA Change: V313E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766
AA Change: V313E

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150398
Predicted Effect probably benign
Transcript: ENSMUST00000166168
AA Change: V373E

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: V373E

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1396:Lrrc49 UTSW 9 60680527 missense probably damaging 0.99
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1817:Lrrc49 UTSW 9 60602776 missense possibly damaging 0.94
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R4772:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
R7144:Lrrc49 UTSW 9 60615156 missense probably damaging 0.99
R7336:Lrrc49 UTSW 9 60677191 missense possibly damaging 0.92
R7541:Lrrc49 UTSW 9 60610403 missense probably damaging 1.00
R7608:Lrrc49 UTSW 9 60602722 missense probably null 1.00
R7739:Lrrc49 UTSW 9 60593692 missense probably benign
Z1176:Lrrc49 UTSW 9 60677221 missense probably damaging 0.99
Z1177:Lrrc49 UTSW 9 60598093 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTCTAGTCACCATAGTAACCC -3'
(R):5'- AATAGGTGTGGACTTAGAAATACGC -3'

Sequencing Primer
(F):5'- CATAGTAACCCATGAGAGTTTCCAGG -3'
(R):5'- GGTGTGGACTTAGAAATACGCAATTC -3'
Posted On2017-08-16