Incidental Mutation 'R6115:Vmn2r85'
ID485091
Institutional Source Beutler Lab
Gene Symbol Vmn2r85
Ensembl Gene ENSMUSG00000092048
Gene Namevomeronasal 2, receptor 85
SynonymsEG623734
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130417772-130429612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 130422803 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 461 (Y461S)
Ref Sequence ENSEMBL: ENSMUSP00000128792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171811]
Predicted Effect probably damaging
Transcript: ENSMUST00000171811
AA Change: Y461S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128792
Gene: ENSMUSG00000092048
AA Change: Y461S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 425 9e-26 PFAM
Pfam:NCD3G 508 562 1.1e-18 PFAM
Pfam:7tm_3 595 831 3.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Pcdhga8 T A 18: 37,727,543 F551I possibly damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Vmn2r85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01298:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL01361:Vmn2r85 APN 10 130418821 missense probably benign 0.22
IGL02185:Vmn2r85 APN 10 130418692 missense probably benign 0.13
IGL02505:Vmn2r85 APN 10 130425580 missense probably damaging 1.00
IGL02607:Vmn2r85 APN 10 130426421 missense possibly damaging 0.89
IGL02755:Vmn2r85 APN 10 130425512 missense probably damaging 0.98
IGL03188:Vmn2r85 APN 10 130418743 missense probably benign 0.16
IGL03366:Vmn2r85 APN 10 130426459 missense probably benign 0.00
IGL03397:Vmn2r85 APN 10 130425394 missense probably damaging 1.00
PIT4445001:Vmn2r85 UTSW 10 130425703 missense probably benign 0.00
R0066:Vmn2r85 UTSW 10 130425901 missense probably damaging 1.00
R0128:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0130:Vmn2r85 UTSW 10 130419185 splice site probably benign
R0503:Vmn2r85 UTSW 10 130422740 missense probably damaging 1.00
R0827:Vmn2r85 UTSW 10 130429518 missense possibly damaging 0.89
R1432:Vmn2r85 UTSW 10 130425286 missense possibly damaging 0.74
R1521:Vmn2r85 UTSW 10 130425919 missense probably damaging 0.99
R2029:Vmn2r85 UTSW 10 130425574 nonsense probably null
R2034:Vmn2r85 UTSW 10 130426373 splice site probably benign
R2852:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R2853:Vmn2r85 UTSW 10 130419166 missense probably benign 0.03
R3084:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3085:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R3430:Vmn2r85 UTSW 10 130418889 missense probably damaging 0.97
R3694:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
R3932:Vmn2r85 UTSW 10 130418467 missense probably damaging 1.00
R4207:Vmn2r85 UTSW 10 130418705 missense probably damaging 1.00
R4628:Vmn2r85 UTSW 10 130425366 missense probably benign 0.00
R4814:Vmn2r85 UTSW 10 130418698 missense probably benign 0.12
R4948:Vmn2r85 UTSW 10 130419121 missense probably damaging 1.00
R4951:Vmn2r85 UTSW 10 130425244 missense probably damaging 1.00
R4959:Vmn2r85 UTSW 10 130421433 missense probably damaging 1.00
R5336:Vmn2r85 UTSW 10 130422705 missense possibly damaging 0.63
R5643:Vmn2r85 UTSW 10 130426474 missense probably damaging 1.00
R6061:Vmn2r85 UTSW 10 130425662 missense probably benign 0.09
R6190:Vmn2r85 UTSW 10 130425461 missense possibly damaging 0.88
R6518:Vmn2r85 UTSW 10 130429412 missense probably benign 0.00
R6533:Vmn2r85 UTSW 10 130426660 missense probably benign 0.00
R6610:Vmn2r85 UTSW 10 130425969 missense probably damaging 0.97
R6809:Vmn2r85 UTSW 10 130425926 missense probably benign
R6962:Vmn2r85 UTSW 10 130425583 missense probably damaging 0.99
R7075:Vmn2r85 UTSW 10 130422688 missense probably benign 0.06
R7104:Vmn2r85 UTSW 10 130426507 missense probably benign
R7424:Vmn2r85 UTSW 10 130418980 missense probably damaging 1.00
R7516:Vmn2r85 UTSW 10 130418983 missense probably damaging 1.00
R7537:Vmn2r85 UTSW 10 130422866 missense probably benign 0.01
R7768:Vmn2r85 UTSW 10 130418693 missense probably damaging 1.00
R7810:Vmn2r85 UTSW 10 130425212 missense probably benign 0.00
R8078:Vmn2r85 UTSW 10 130429495 nonsense probably null
R8115:Vmn2r85 UTSW 10 130425951 missense probably benign 0.06
R8262:Vmn2r85 UTSW 10 130418869 missense probably damaging 0.98
R8395:Vmn2r85 UTSW 10 130425928 missense probably damaging 0.99
R8409:Vmn2r85 UTSW 10 130425388 missense probably benign 0.16
R8547:Vmn2r85 UTSW 10 130425442 missense probably damaging 1.00
R8875:Vmn2r85 UTSW 10 130418302 missense probably damaging 0.99
Z1176:Vmn2r85 UTSW 10 130425844 missense probably damaging 0.99
Z1177:Vmn2r85 UTSW 10 130418907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTTTTGCAAGAGTAGCAATTAGTC -3'
(R):5'- CTGAAAGTCATTAGGAAATTGGTGG -3'

Sequencing Primer
(F):5'- TAACCACAATGCTCGTACTTCAGTG -3'
(R):5'- GGTGGAAATTCTCAATTTTGCATTCC -3'
Posted On2017-08-16