Mutagenetix > Incidental Mutations

Incidental Mutation 'R6115:Kif13a'

485094

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

044264-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.351) question?

Stock #

R6115 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46801313 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 648 (I648F)

Ref Sequence

ENSEMBL: ENSMUSP00000153614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056978
AA Change: I711F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: I711F

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225591
AA Change: I648F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.1311

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	G	5: 63,897,974	Q18E	probably damaging	Het
Acsf3	T	A	8: 122,790,672	H402Q	probably damaging	Het
Adam34	T	G	8: 43,652,061	Q182H	probably benign	Het
Alx1	G	A	10: 103,028,443	P55L	possibly damaging	Het
Arhgef38	A	T	3: 133,132,613		probably null	Het
Ccdc102a	T	C	8: 94,903,371	N514S	probably benign	Het
Corin	T	A	5: 72,360,729	T317S	probably damaging	Het
Ctnna2	A	G	6: 77,636,839	V256A	probably benign	Het
Dhx29	A	T	13: 112,952,801		probably null	Het
Dnah2	C	A	11: 69,446,649	D3209Y	probably damaging	Het
Dnhd1	A	G	7: 105,713,987	T3919A	probably benign	Het
F7	T	A	8: 13,033,958	N214K	probably benign	Het
Fam3b	T	G	16: 97,475,368	Q177H	possibly damaging	Het
Fign	T	C	2: 63,979,310	I539V	probably benign	Het
Hc	T	G	2: 35,013,038	D1067A	probably damaging	Het
Herc6	A	G	6: 57,583,206	D77G	probably benign	Het
Hmg20a	A	T	9: 56,489,832	E305D	possibly damaging	Het
Il16	G	A	7: 83,652,567	Q116*	probably null	Het
Lactb	G	T	9: 66,967,687	N374K	possibly damaging	Het
Lmx1b	T	C	2: 33,569,106	D145G	probably damaging	Het
Lrfn4	T	C	19: 4,613,909	D199G	probably damaging	Het
Lrrc49	A	T	9: 60,615,161	V307E	possibly damaging	Het
Magi1	A	C	6: 93,708,070	S776A	possibly damaging	Het
Mthfsl	T	A	9: 88,688,754	*147L	probably null	Het
Nsmce4a	G	T	7: 130,546,992	Q95K	probably benign	Het
Olfr1281	A	G	2: 111,329,213	T265A	probably benign	Het
Olfr1299	A	T	2: 111,664,642	K139*	probably null	Het
Olfr1449	T	C	19: 12,935,584	V282A	possibly damaging	Het
Olfr344	A	T	2: 36,568,951	M118L	probably damaging	Het
Pcdha7	A	G	18: 36,974,735	E271G	probably damaging	Het
Pcdhga8	T	A	18: 37,727,543	F551I	possibly damaging	Het
Prpf31	T	C	7: 3,639,706		probably null	Het
Qrfpr	C	T	3: 36,182,593	V220I	possibly damaging	Het
Rnf170	T	C	8: 26,125,966	F95S	possibly damaging	Het
Scn9a	T	A	2: 66,563,629	Y200F	possibly damaging	Het
Sfpq	A	T	4: 127,021,348		probably null	Het
Slc9c1	A	T	16: 45,555,769	Y406F	probably damaging	Het
Stk32c	G	T	7: 139,120,712	Y200*	probably null	Het
Svil	A	G	18: 5,108,675	R1938G	probably damaging	Het
Sycp2	G	C	2: 178,348,245	R1403G	probably benign	Het
Tm9sf4	T	C	2: 153,182,489		probably null	Het
Tmc3	A	T	7: 83,614,962	M633L	possibly damaging	Het
Tmem163	T	C	1: 127,677,448	D61G	possibly damaging	Het
Unc5b	C	A	10: 60,777,546	A304S	probably benign	Het
Vmn2r106	G	A	17: 20,268,376	P587L	probably benign	Het
Vmn2r18	A	T	5: 151,584,997	S221T	possibly damaging	Het
Vmn2r85	T	G	10: 130,422,803	Y461S	probably damaging	Het
Yod1	T	C	1: 130,719,063	F226L	possibly damaging	Het
Zbtb4	T	C	11: 69,776,322	I151T	probably damaging	Het
Zfp110	A	T	7: 12,849,774	Q783L	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- CCCAGTATGCTTACCCATGG -3'
(R):5'- GTTACCGTTTCCTGGCAGTC -3'

Sequencing Primer
(F):5'- GGTAAATACCAACCCCCGC -3'
(R):5'- AGTCCCGCACGCTGAGAAAG -3'

Posted On

2017-08-16