Incidental Mutation 'R6115:Slc9c1'
ID 485096
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission 044264-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R6115 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45376132 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 406 (Y406F)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably damaging
Transcript: ENSMUST00000159945
AA Change: Y406F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: Y406F

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162151
AA Change: Y377F
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 64,055,317 (GRCm39) Q18E probably damaging Het
Acsf3 T A 8: 123,517,411 (GRCm39) H402Q probably damaging Het
Adam34 T G 8: 44,105,098 (GRCm39) Q182H probably benign Het
Alx1 G A 10: 102,864,304 (GRCm39) P55L possibly damaging Het
Arhgef38 A T 3: 132,838,374 (GRCm39) probably null Het
Ccdc102a T C 8: 95,629,999 (GRCm39) N514S probably benign Het
Corin T A 5: 72,518,072 (GRCm39) T317S probably damaging Het
Ctnna2 A G 6: 77,613,822 (GRCm39) V256A probably benign Het
Dhx29 A T 13: 113,089,335 (GRCm39) probably null Het
Dnah2 C A 11: 69,337,475 (GRCm39) D3209Y probably damaging Het
Dnhd1 A G 7: 105,363,194 (GRCm39) T3919A probably benign Het
F7 T A 8: 13,083,958 (GRCm39) N214K probably benign Het
Fam3b T G 16: 97,276,568 (GRCm39) Q177H possibly damaging Het
Fign T C 2: 63,809,654 (GRCm39) I539V probably benign Het
Hc T G 2: 34,903,050 (GRCm39) D1067A probably damaging Het
Herc6 A G 6: 57,560,191 (GRCm39) D77G probably benign Het
Hmg20a A T 9: 56,397,116 (GRCm39) E305D possibly damaging Het
Il16 G A 7: 83,301,775 (GRCm39) Q116* probably null Het
Kif13a T A 13: 46,954,789 (GRCm39) I648F probably damaging Het
Lactb G T 9: 66,874,969 (GRCm39) N374K possibly damaging Het
Lmx1b T C 2: 33,459,118 (GRCm39) D145G probably damaging Het
Lrfn4 T C 19: 4,663,937 (GRCm39) D199G probably damaging Het
Lrrc49 A T 9: 60,522,444 (GRCm39) V307E possibly damaging Het
Magi1 A C 6: 93,685,051 (GRCm39) S776A possibly damaging Het
Mthfsl T A 9: 88,570,807 (GRCm39) *147L probably null Het
Nsmce4a G T 7: 130,148,722 (GRCm39) Q95K probably benign Het
Or1j15 A T 2: 36,458,963 (GRCm39) M118L probably damaging Het
Or4k37 A G 2: 111,159,558 (GRCm39) T265A probably benign Het
Or4k49 A T 2: 111,494,987 (GRCm39) K139* probably null Het
Or5b24 T C 19: 12,912,948 (GRCm39) V282A possibly damaging Het
Pcdha7 A G 18: 37,107,788 (GRCm39) E271G probably damaging Het
Pcdhga8 T A 18: 37,860,596 (GRCm39) F551I possibly damaging Het
Prpf31 T C 7: 3,642,705 (GRCm39) probably null Het
Qrfpr C T 3: 36,236,742 (GRCm39) V220I possibly damaging Het
Rnf170 T C 8: 26,615,994 (GRCm39) F95S possibly damaging Het
Scn9a T A 2: 66,393,973 (GRCm39) Y200F possibly damaging Het
Sfpq A T 4: 126,915,141 (GRCm39) probably null Het
Stk32c G T 7: 138,700,628 (GRCm39) Y200* probably null Het
Svil A G 18: 5,108,675 (GRCm39) R1938G probably damaging Het
Sycp2 G C 2: 177,990,038 (GRCm39) R1403G probably benign Het
Tm9sf4 T C 2: 153,024,409 (GRCm39) probably null Het
Tmc3 A T 7: 83,264,170 (GRCm39) M633L possibly damaging Het
Tmem163 T C 1: 127,605,185 (GRCm39) D61G possibly damaging Het
Unc5b C A 10: 60,613,325 (GRCm39) A304S probably benign Het
Vmn2r106 G A 17: 20,488,638 (GRCm39) P587L probably benign Het
Vmn2r18 A T 5: 151,508,462 (GRCm39) S221T possibly damaging Het
Vmn2r85 T G 10: 130,258,672 (GRCm39) Y461S probably damaging Het
Yod1 T C 1: 130,646,800 (GRCm39) F226L possibly damaging Het
Zbtb4 T C 11: 69,667,148 (GRCm39) I151T probably damaging Het
Zfp110 A T 7: 12,583,701 (GRCm39) Q783L probably damaging Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9695:Slc9c1 UTSW 16 45,368,026 (GRCm39) missense probably benign 0.00
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGCTCACCAGGAATACAGTAG -3'
(R):5'- AGTCCTTGTCACAAAGCTCTCC -3'

Sequencing Primer
(F):5'- AGAATAAAACAGAAAGACACGTCTAC -3'
(R):5'- GTCACAAAGCTCTCCTTATAGGG -3'
Posted On 2017-08-16