Incidental Mutation 'R6115:Pcdhga8'
ID485101
Institutional Source Beutler Lab
Gene Symbol Pcdhga8
Ensembl Gene ENSMUSG00000103897
Gene Nameprotocadherin gamma subfamily A, 8
Synonyms
MMRRC Submission 044264-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6115 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37725706-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37727543 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 551 (F551I)
Ref Sequence ENSEMBL: ENSMUSP00000067728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066149] [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192535] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000195823] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066149
AA Change: F551I

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067728
Gene: ENSMUSG00000103897
AA Change: F551I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 31 131 4.84e-2 SMART
CA 155 240 1.48e-22 SMART
CA 264 345 1.14e-23 SMART
CA 369 450 9.44e-21 SMART
CA 474 560 1.03e-26 SMART
CA 591 669 3.64e-13 SMART
Pfam:Cadherin_C_2 688 772 3e-25 PFAM
Pfam:Cadherin_tail 809 932 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192535
SMART Domains Protein: ENSMUSP00000142010
Gene: ENSMUSG00000103749

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 8e-3 SMART
CA 155 240 2.49e-20 SMART
CA 264 341 4.97e-29 SMART
CA 365 446 1.09e-25 SMART
CA 470 556 1.75e-24 SMART
CA 587 668 9.18e-10 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193006
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193815
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195069
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Meta Mutation Damage Score 0.2375 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C G 5: 63,897,974 Q18E probably damaging Het
Acsf3 T A 8: 122,790,672 H402Q probably damaging Het
Adam34 T G 8: 43,652,061 Q182H probably benign Het
Alx1 G A 10: 103,028,443 P55L possibly damaging Het
Arhgef38 A T 3: 133,132,613 probably null Het
Ccdc102a T C 8: 94,903,371 N514S probably benign Het
Corin T A 5: 72,360,729 T317S probably damaging Het
Ctnna2 A G 6: 77,636,839 V256A probably benign Het
Dhx29 A T 13: 112,952,801 probably null Het
Dnah2 C A 11: 69,446,649 D3209Y probably damaging Het
Dnhd1 A G 7: 105,713,987 T3919A probably benign Het
F7 T A 8: 13,033,958 N214K probably benign Het
Fam3b T G 16: 97,475,368 Q177H possibly damaging Het
Fign T C 2: 63,979,310 I539V probably benign Het
Hc T G 2: 35,013,038 D1067A probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmg20a A T 9: 56,489,832 E305D possibly damaging Het
Il16 G A 7: 83,652,567 Q116* probably null Het
Kif13a T A 13: 46,801,313 I648F probably damaging Het
Lactb G T 9: 66,967,687 N374K possibly damaging Het
Lmx1b T C 2: 33,569,106 D145G probably damaging Het
Lrfn4 T C 19: 4,613,909 D199G probably damaging Het
Lrrc49 A T 9: 60,615,161 V307E possibly damaging Het
Magi1 A C 6: 93,708,070 S776A possibly damaging Het
Mthfsl T A 9: 88,688,754 *147L probably null Het
Nsmce4a G T 7: 130,546,992 Q95K probably benign Het
Olfr1281 A G 2: 111,329,213 T265A probably benign Het
Olfr1299 A T 2: 111,664,642 K139* probably null Het
Olfr1449 T C 19: 12,935,584 V282A possibly damaging Het
Olfr344 A T 2: 36,568,951 M118L probably damaging Het
Pcdha7 A G 18: 36,974,735 E271G probably damaging Het
Prpf31 T C 7: 3,639,706 probably null Het
Qrfpr C T 3: 36,182,593 V220I possibly damaging Het
Rnf170 T C 8: 26,125,966 F95S possibly damaging Het
Scn9a T A 2: 66,563,629 Y200F possibly damaging Het
Sfpq A T 4: 127,021,348 probably null Het
Slc9c1 A T 16: 45,555,769 Y406F probably damaging Het
Stk32c G T 7: 139,120,712 Y200* probably null Het
Svil A G 18: 5,108,675 R1938G probably damaging Het
Sycp2 G C 2: 178,348,245 R1403G probably benign Het
Tm9sf4 T C 2: 153,182,489 probably null Het
Tmc3 A T 7: 83,614,962 M633L possibly damaging Het
Tmem163 T C 1: 127,677,448 D61G possibly damaging Het
Unc5b C A 10: 60,777,546 A304S probably benign Het
Vmn2r106 G A 17: 20,268,376 P587L probably benign Het
Vmn2r18 A T 5: 151,584,997 S221T possibly damaging Het
Vmn2r85 T G 10: 130,422,803 Y461S probably damaging Het
Yod1 T C 1: 130,719,063 F226L possibly damaging Het
Zbtb4 T C 11: 69,776,322 I151T probably damaging Het
Zfp110 A T 7: 12,849,774 Q783L probably damaging Het
Other mutations in Pcdhga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
G1patch:Pcdhga8 UTSW 18 37727262 missense probably damaging 1.00
R4017:Pcdhga8 UTSW 18 37815738 missense probably damaging 1.00
R4182:Pcdhga8 UTSW 18 37727283 missense probably damaging 1.00
R4504:Pcdhga8 UTSW 18 37816763 missense probably damaging 0.97
R4506:Pcdhga8 UTSW 18 37816763 missense probably damaging 0.97
R4850:Pcdhga8 UTSW 18 37727709 missense probably damaging 1.00
R4851:Pcdhga8 UTSW 18 37816404 missense probably damaging 0.99
R4857:Pcdhga8 UTSW 18 37726914 missense probably damaging 1.00
R4902:Pcdhga8 UTSW 18 37815925 missense probably damaging 1.00
R5235:Pcdhga8 UTSW 18 37727435 missense probably damaging 1.00
R5254:Pcdhga8 UTSW 18 37726620 missense probably benign 0.01
R5646:Pcdhga8 UTSW 18 37726770 missense probably benign
R5943:Pcdhga8 UTSW 18 37816512 missense probably damaging 1.00
R6130:Pcdhga8 UTSW 18 37727527 missense possibly damaging 0.88
R6631:Pcdhga8 UTSW 18 37727056 missense probably benign
R6725:Pcdhga8 UTSW 18 37727262 missense probably damaging 1.00
R6915:Pcdhga8 UTSW 18 37725945 missense probably benign 0.01
R7000:Pcdhga8 UTSW 18 37726893 missense probably benign 0.11
R7027:Pcdhga8 UTSW 18 37727111 missense probably benign
R7406:Pcdhga8 UTSW 18 37726185 missense possibly damaging 0.93
R7481:Pcdhga8 UTSW 18 37727937 missense probably benign
R7491:Pcdhga8 UTSW 18 37727430 missense probably benign 0.00
R7625:Pcdhga8 UTSW 18 37726901 missense probably benign 0.05
R7712:Pcdhga8 UTSW 18 37727049 missense possibly damaging 0.67
R7740:Pcdhga8 UTSW 18 37727417 missense probably benign 0.22
R7912:Pcdhga8 UTSW 18 37726843 missense probably benign 0.00
R7917:Pcdhga8 UTSW 18 37727616 missense possibly damaging 0.94
R8017:Pcdhga8 UTSW 18 37727730 missense probably damaging 1.00
R8037:Pcdhga8 UTSW 18 37727018 missense probably damaging 1.00
R8066:Pcdhga8 UTSW 18 37726382 missense probably benign 0.00
R8228:Pcdhga8 UTSW 18 37728183 missense probably benign
R8744:Pcdhga8 UTSW 18 37727774 missense probably damaging 1.00
R8938:Pcdhga8 UTSW 18 37726902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTGCACATGACCCTGAC -3'
(R):5'- GGTAGGACAGCCAAGCATTCTG -3'

Sequencing Primer
(F):5'- GAGAATGCCCAGGTCACTTACTCTG -3'
(R):5'- AGCCAAGCATTCTGTCCCGAG -3'
Posted On2017-08-16