Incidental Mutation 'R6116:Bpifa3'
ID485106
Institutional Source Beutler Lab
Gene Symbol Bpifa3
Ensembl Gene ENSMUSG00000027482
Gene NameBPI fold containing family A, member 3
Synonyms
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6116 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location154130336-154138356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 154133713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 68 (V68I)
Ref Sequence ENSEMBL: ENSMUSP00000105368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028984] [ENSMUST00000109746] [ENSMUST00000125753]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028984
AA Change: V68I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028984
Gene: ENSMUSG00000027482
AA Change: V68I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 47 219 1.2e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109746
AA Change: V68I

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105368
Gene: ENSMUSG00000027482
AA Change: V68I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:LBP_BPI_CETP 47 219 1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125753
SMART Domains Protein: ENSMUSP00000135866
Gene: ENSMUSG00000027482

DomainStartEndE-ValueType
Pfam:LBP_BPI_CETP 1 95 4.1e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc2a10 A C 2: 165,517,703 T496P probably damaging Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Bpifa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Bpifa3 APN 2 154137582 missense probably damaging 1.00
R0023:Bpifa3 UTSW 2 154138150 missense probably damaging 0.97
R1067:Bpifa3 UTSW 2 154137609 missense probably damaging 1.00
R4163:Bpifa3 UTSW 2 154135596 missense probably damaging 0.97
R4614:Bpifa3 UTSW 2 154136280 missense probably damaging 0.99
R5124:Bpifa3 UTSW 2 154138137 nonsense probably null
R5704:Bpifa3 UTSW 2 154137642 critical splice donor site probably null
R5706:Bpifa3 UTSW 2 154135578 missense probably damaging 0.98
R5975:Bpifa3 UTSW 2 154136321 missense probably damaging 0.96
R6858:Bpifa3 UTSW 2 154137594 missense probably benign 0.12
Z1176:Bpifa3 UTSW 2 154130471 start gained probably benign
Z1177:Bpifa3 UTSW 2 154136292 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAAGGGATACGCTGGGTTCG -3'
(R):5'- GAGTGGTCCCTAGATTGTTCTCATC -3'

Sequencing Primer
(F):5'- TTCGTCCCAGGCCTGCTG -3'
(R):5'- GGTCCCTAGATTGTTCTCATCTTTGG -3'
Posted On2017-08-16