Incidental Mutation 'R6116:Slc2a10'
ID485107
Institutional Source Beutler Lab
Gene Symbol Slc2a10
Ensembl Gene ENSMUSG00000027661
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 10
SynonymsGlut10
MMRRC Submission 044265-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6116 (G1)
Quality Score220.009
Status Not validated
Chromosome2
Chromosomal Location165503787-165519917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 165517703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 496 (T496P)
Ref Sequence ENSEMBL: ENSMUSP00000029196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029196]
Predicted Effect probably damaging
Transcript: ENSMUST00000029196
AA Change: T496P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029196
Gene: ENSMUSG00000027661
AA Change: T496P

DomainStartEndE-ValueType
Pfam:Sugar_tr 10 333 1.7e-51 PFAM
Pfam:MFS_1 14 337 1.1e-28 PFAM
Pfam:Sugar_tr 387 508 3.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148463
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a class III facilitative glucose transporter. Mutations in the related gene in human are associated with arterial tortuosity syndrome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice carrying ENU-induced mutations in this gene display thickening and aberrant vessel wall shape of large and medium size arteries, with significantly increased elastic fiber number and size. Cerebral arteries appear normal with no evidence of tortuosity, stenosis/dilatation or aneurysm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T A 19: 9,012,963 probably benign Het
Apc A T 18: 34,316,455 I2101F probably damaging Het
Bpifa3 G A 2: 154,133,713 V68I possibly damaging Het
Csmd1 T A 8: 16,211,850 I878F probably damaging Het
Cyp2c67 A T 19: 39,617,435 M339K probably damaging Het
Dock3 A G 9: 106,931,962 Y1321H probably damaging Het
Dsc1 G T 18: 20,097,299 D316E probably benign Het
Eno3 C T 11: 70,661,575 T351M possibly damaging Het
Erbb2 T A 11: 98,427,399 F487Y probably damaging Het
Exosc10 T C 4: 148,573,353 L652P probably benign Het
Glmn A T 5: 107,557,340 M470K probably damaging Het
Gm15446 T A 5: 109,943,036 C385S probably damaging Het
Gm597 G A 1: 28,778,699 A84V probably benign Het
Hspa8 A G 9: 40,804,975 E581G probably damaging Het
Igfn1 T C 1: 135,970,467 D787G probably benign Het
Igkv12-44 T C 6: 69,814,854 T42A possibly damaging Het
Itsn2 T C 12: 4,629,939 probably benign Het
Jade2 T C 11: 51,835,633 E84G probably damaging Het
Lpar3 T A 3: 146,240,597 M10K possibly damaging Het
Lpin2 A G 17: 71,243,930 D695G probably damaging Het
Mosmo T A 7: 120,726,195 L7H probably damaging Het
Ms4a8a C T 19: 11,081,072 A9T unknown Het
Myb T C 10: 21,154,754 D48G probably damaging Het
Neurod6 T C 6: 55,678,791 Y287C probably damaging Het
Olfr878 A G 9: 37,918,659 M1V probably null Het
Olfr96 A G 17: 37,225,568 T148A probably benign Het
Olr1 T A 6: 129,499,984 D106V probably damaging Het
Peg10 C CCCATCAGGA 6: 4,756,351 probably benign Het
Plch1 C T 3: 63,702,023 R912H probably damaging Het
Ppfia3 T C 7: 45,354,703 Y505C probably damaging Het
Sdk2 T A 11: 113,854,364 I702F probably damaging Het
Slc16a11 T C 11: 70,215,436 F119L probably benign Het
Slc7a2 T C 8: 40,900,169 Y181H probably damaging Het
Stab2 G T 10: 86,907,190 P1185Q probably damaging Het
Tcf7l2 T A 19: 55,919,014 S335R probably damaging Het
Ttc41 G A 10: 86,759,088 probably null Het
Vmn2r32 A T 7: 7,464,093 I812N probably damaging Het
Wdr24 C T 17: 25,824,605 H134Y probably benign Het
Other mutations in Slc2a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Slc2a10 APN 2 165514780 missense probably damaging 1.00
IGL01465:Slc2a10 APN 2 165517677 missense possibly damaging 0.88
IGL02565:Slc2a10 APN 2 165515080 missense probably damaging 0.99
IGL02902:Slc2a10 APN 2 165518222 missense probably benign 0.08
PIT4362001:Slc2a10 UTSW 2 165516293 missense probably damaging 1.00
R1453:Slc2a10 UTSW 2 165517650 missense probably damaging 1.00
R1677:Slc2a10 UTSW 2 165515441 missense probably benign 0.04
R1850:Slc2a10 UTSW 2 165515213 missense probably benign 0.00
R1920:Slc2a10 UTSW 2 165514630 missense probably damaging 1.00
R2269:Slc2a10 UTSW 2 165514781 nonsense probably null
R3921:Slc2a10 UTSW 2 165515601 missense probably benign 0.00
R4407:Slc2a10 UTSW 2 165514764 missense probably damaging 1.00
R4575:Slc2a10 UTSW 2 165516321 missense probably damaging 1.00
R4864:Slc2a10 UTSW 2 165514621 missense probably benign 0.13
R4923:Slc2a10 UTSW 2 165514756 missense possibly damaging 0.62
R4935:Slc2a10 UTSW 2 165517658 missense probably benign 0.05
R4954:Slc2a10 UTSW 2 165514755 missense probably damaging 0.99
R5681:Slc2a10 UTSW 2 165514740 missense probably benign 0.00
R5782:Slc2a10 UTSW 2 165514838 nonsense probably null
R6713:Slc2a10 UTSW 2 165515208 missense probably damaging 1.00
R7179:Slc2a10 UTSW 2 165515349 missense probably damaging 1.00
R7237:Slc2a10 UTSW 2 165515277 missense probably benign
R7568:Slc2a10 UTSW 2 165514882 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAACTGCTGGCTCTACACC -3'
(R):5'- AGCCACCGTCTAATGATACAAGATAG -3'

Sequencing Primer
(F):5'- TCTACACCCAGGAGCTGCTTG -3'
(R):5'- CGTCTAATGATACAAGATAGCTGAAG -3'
Posted On2017-08-16